Searching with a sequence using BLAT or BLAST

 

If you have a sequence, but you are not sure what the gene name or Ensembl ID is, you can align it to the genome with BLAST or BLAT.

 

Steps BLAT with the MTAP4 gene sequence

Try it! The beginning of the MTAP4 gene sequence is shown. Copy it and move on to the steps below.

CTCCGCACTGCTCACTCCCGCGCAGTGAGGTTGGCACAGCCACC
CTCTGTGGCTCGCTTGGTTCCCTTAGTCCCGAGCGCTCGCCCAC
TGCAGATTCCTTTCCCGTGCAGACATGGCCT

 

  1. Click on the BLAST/BLAT link at the top of the page.
  2. Paste your sequence into the box. 
  3. Check the options are correct. For example, we have selected Homo sapiens as the species to search against and the BLAT search tool because we're looking for an identical match.
  4. Click 'Run'. 
InformationBLAT vs BLAST ... What's the Difference?                

BLAT (The BLAST-Like Alignment Tool) is fast, but it demands more exact matches. BLAST will allow lower-scoring hits, and allows more gaps in alignments. You'll get more hits with BLAST (but it may be slower).