0%

Searching with a sequence using BLAT or BLAST

If you have a sequence, but you are not sure what the gene name or Ensembl ID is, you can align it to the genome with BLAST or BLAT (Video 3).

Video 3 The Ensembl BLAST and BLAT tools

Try it!

BLAT with the MTAP gene sequence

The beginning of the MTAP gene sequence is shown. Copy it and move on to the steps below.

CTCCGCACTGCTCACTCCCGCGCAGTGAGGTTGGCACAGCCACC CTCTGTGGCTCGCTTGGTTCCCTTAGTCCCGAGCGCTCGCCCAC TGCAGATTCCTTTCCCGTGCAGACATGGCCT

  1. Click on the BLAST/BLAT link at the top of the page.
  2. Paste your sequence into the box. 
  3. Check the options are correct. For example, we have selected Homo sapiens as the species to search against and the BLAT search tool because we’re looking for an identical match.
  4. Click ‘Run’. 
 BLAT vs BLAST … What’s the Difference?
BLAT (The BLAST-Like Alignment Tool) is fast, but it demands more exact matches. BLAST will allow lower-scoring hits, and allows more gaps in alignments. You’ll get more hits with BLAST (but it may be slower).