- Course overview
- Search within this course
- Why Ensembl?
- What is Ensembl?
- When to use Ensembl
- How to access Ensembl
- Exploring sources of biological data
- Navigating Ensembl
- Customise Ensembl
- Manage your data
- Export data
- Download data with BioMart
- Bulk download genome-wide data files with FTP
- Ensembl tools
- Summary
- Guided examples of using Ensembl
- Exercises
- Your feedback
- Get help and support on Ensembl
- Acknowledgements
- Learn more
Searching with a sequence using BLAT or BLAST
If you have a sequence, but you are not sure what the gene name or Ensembl ID is, you can align it to the genome with BLAST or BLAT (Video 3).
Try it!
BLAT with the MTAP gene sequence
The beginning of the MTAP gene sequence is shown. Copy it and move on to the steps below.
CTCCGCACTGCTCACTCCCGCGCAGTGAGGTTGGCACAGCCACC CTCTGTGGCTCGCTTGGTTCCCTTAGTCCCGAGCGCTCGCCCAC TGCAGATTCCTTTCCCGTGCAGACATGGCCT
- Click on the BLAST/BLAT link at the top of the page.
- Paste your sequence into the box.
- Check the options are correct. For example, we have selected Homo sapiens as the species to search against and the BLAT search tool because we’re looking for an identical match.
- Click ‘Run’.
BLAT vs BLAST … What’s the Difference? BLAT (The BLAST-Like Alignment Tool) is fast, but it demands more exact matches. BLAST will allow lower-scoring hits, and allows more gaps in alignments. You’ll get more hits with BLAST (but it may be slower). |