- Course overview
- Search within this course
- Why Ensembl?
- What is Ensembl?
- When to use Ensembl
- How to access Ensembl
- How to search Ensembl
- How to search Ensembl
- How to search Ensembl
- Exploring sources of biological data
- Navigating Ensembl
- Customise Ensembl
- Manage your data
- Export data
- Download data with BioMart
- Bulk download genome-wide data files with FTP
- Ensembl tools
- Summary
- Exercises
- Your feedback
- Get help and support on Ensembl
- Acknowledgements
- Learn more
All materials are free cultural works licensed under a Creative Commons Attribution 4.0 International (CC BY 4.0) license, except where further licensing details are provided.
Using a sequence to find a gene (BLAST/BLAT)
Background
If you do not have a gene name, an ID, or an accession number for your sequence of interest, Ensembl provides an interface that allows you to use BLAST or BLAT to align your sequence to the genome. You can then find out whether there is an Ensembl gene in that area.
Scenario
Imagine that you have sequenced a human gene that is associated with cancer. You know part of the DNA sequence, and that mutations in the sequence are associated with colon cancer, but you do not know which gene it belongs to. You can use Ensembl BLAST/BLAT to see if any genes correspond to your sequence.
CTCCGCACTGCTCACTCCCGCGCAGTGAGGTTGGCACAGCCACCGCTCTGT GGCTCGCTTGGTTCCCTTAGTCCCGAGCGCTCGCCCACTGCAGATTCCTTTCCCGTGCAGACATGGCCT