Using a sequence to find a gene (BLAST/BLAT)

Using a sequence to find a gene

Background

If you do not have a gene name, an ID, or an accession number for your sequence of interest, Ensembl provides an interface that allows you to use BLAST or BLAT to align your sequence to the genome. You can then find out whether there is an Ensembl gene in that area.

Scenario

Imagine that you have sequenced a human gene that is associated with cancer. You know part of the DNA sequence, and that mutations in the sequence are associated with colon cancer, but you do not know which gene it belongs to. You can use Ensembl BLAST/BLAT to see if any genes correspond to your sequence.

 

Notes

CTCCGCACTGCTCACTCCCGCGCAGTGAGGTTGGCACAGCCACCGCTCTGT

GGCTCGCTTGGTTCCCTTAGTCCCGAGCGCTCGCCCACTGCAGATTCCTTTC

CCGTGCAGACATGGCCT