HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept
{
"links": {
"first": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572/samples?format=api&page=1",
"last": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572/samples?format=api&page=1",
"next": null,
"prev": null
},
"data": [
{
"type": "samples",
"id": "ERS514153",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673218",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "296",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-03-09",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "ACGGGGCGCAGCAGGCGCGA, CCCGGGTATCTAATCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TACATA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "2.19",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "460",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "2920",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.0014",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "420000 / mL",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.9",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "897",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514153",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater archaea",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR13A",
"sample-alias": "OL-KR13A",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514153/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514153/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514153?format=api"
}
},
{
"type": "samples",
"id": "ERS514154",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673219",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "296",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-03-09",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "AGAGTTTGATCCTGGCTCAG. ATTACCGCGGCTGCTGG",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ACACTG",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "2.19",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "460",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "2920",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.0014",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "420000 / mL",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.9",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "897",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514154",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater bacteria",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR13B",
"sample-alias": "OL-KR13B",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514154/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514154/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514154?format=api"
}
},
{
"type": "samples",
"id": "ERS514155",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673220",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "296",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-03-09",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "GTGTAGCAGTTACCGCA, CAACATCGTYCAYACCCAGGG",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TGAGCA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "2.19",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "460",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "2920",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.0014",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "420000 / mL",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.9",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "153939",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "897",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514155",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater sulphate reducer",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR13D",
"sample-alias": "OL-KR13D",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514155/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514155/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514155?format=api"
}
},
{
"type": "samples",
"id": "ERS514156",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673221",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "328",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-05-18",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "ACGGGGCGCAGCAGGCGCGA, CCCGGGTATCTAATCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ACTCAG",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.37",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "1100",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "6230",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.003",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "100000 /ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.9",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "1832",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514156",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater archaea",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR6A",
"sample-alias": "OL-KR6A",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514156/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514156/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514156?format=api"
}
},
{
"type": "samples",
"id": "ERS514157",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673222",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "328",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-05-18",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "AGAGTTTGATCCTGGCTCAG",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "CGCTAC",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.37",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "1100",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "6230",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.003",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "100000 /ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.9",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "1832",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514157",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater bacteria",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR6B",
"sample-alias": "OL-KR6B",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514157/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514157/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514157?format=api"
}
},
{
"type": "samples",
"id": "ERS514158",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673223",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "328",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-05-18",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "GTGTAGCAGTTACCGCA, CAACATCGTYCAYACCCAGGG",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TCTATG",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.37",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "1100",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "6230",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.003",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "100000 /ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.9",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "153939",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "1832",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514158",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater sulphate reducer",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR6D",
"sample-alias": "OL-KR6D",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514158/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514158/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514158?format=api"
}
},
{
"type": "samples",
"id": "ERS514159",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673224",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "328",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-05-18",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "GCMATGCARATHGGWATGTC, TGTGTGAAWCCKACDCCACC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TCTATG",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.37",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "1100",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "6230",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.003",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "100000 /ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.9",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "198240",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "1832",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514159",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater methanogen",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR6M",
"sample-alias": "OL-KR6M",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514159/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514159/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514159?format=api"
}
},
{
"type": "samples",
"id": "ERS514160",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673225",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "347",
"unit": "m"
},
{
"key": "collection date",
"value": "2009-12-15",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "ACGGGGCGCAGCAGGCGCGA, CCCGGGTATCTAATCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ACTCAG",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "2100",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "7930",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.002",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "250000 / ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.5",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2190",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514160",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater archaea",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR23A",
"sample-alias": "OL-KR23A",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514160/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514160/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514160?format=api"
}
},
{
"type": "samples",
"id": "ERS514161",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673226",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "347",
"unit": "m"
},
{
"key": "collection date",
"value": "2009-12-15",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "AGAGTTTGATCCTGGCTCAG",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "CGCTAC",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "2100",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "7930",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.002",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "250000 / ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.5",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2190",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514161",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater bacteria",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR23B",
"sample-alias": "OL-KR23B",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514161/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514161/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514161?format=api"
}
},
{
"type": "samples",
"id": "ERS514162",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673227",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "347",
"unit": "m"
},
{
"key": "collection date",
"value": "2009-12-15",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "GTGTAGCAGTTACCGCA, CAACATCGTYCAYACCCAGGG",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TCTATG",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "2100",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "7930",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.002",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "250000 / ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.5",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "153939",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2190",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514162",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater sulphate reducer",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR23D",
"sample-alias": "OL-KR23D",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514162/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514162/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514162?format=api"
}
},
{
"type": "samples",
"id": "ERS514163",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673228",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "347",
"unit": "m"
},
{
"key": "collection date",
"value": "2009-12-15",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "GCMATGCARATHGGWATGTC, TGTGTGAAWCCKACDCCACC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TCTATG",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "2100",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "7930",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.002",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "250000 / ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.5",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "198240",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2190",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514163",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater methanogen",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR23M",
"sample-alias": "OL-KR23M",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514163/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514163/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514163?format=api"
}
},
{
"type": "samples",
"id": "ERS514164",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673229",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "415",
"unit": "m"
},
{
"key": "collection date",
"value": "2009-12-14",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "ACGGGGCGCAGCAGGCGCGA, CCCGGGTATCTAATCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TACATA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.16",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "2700",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "9940",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.0008",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "15000 / ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "8.1",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2670",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514164",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater archaea",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR49A",
"sample-alias": "OL-KR49A",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514164/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514164/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514164?format=api"
}
},
{
"type": "samples",
"id": "ERS514165",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673230",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "415",
"unit": "m"
},
{
"key": "collection date",
"value": "2009-12-14",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "AGAGTTTGATCCTGGCTCAG",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ACACTG",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.16",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "2700",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "9940",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.0008",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "15000 / ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "8.1",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2670",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514165",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater bacteria",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR49B",
"sample-alias": "OL-KR49B",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514165/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514165/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514165?format=api"
}
},
{
"type": "samples",
"id": "ERS514166",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673231",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "415",
"unit": "m"
},
{
"key": "collection date",
"value": "2009-12-14",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "GTGTAGCAGTTACCGCA, CAACATCGTYCAYACCCAGGG",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TGAGCA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.16",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "2700",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "9940",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.0008",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "15000 / ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "8.1",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "153939",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2670",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514166",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater sulphate reducer",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR49D",
"sample-alias": "OL-KR49D",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514166/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514166/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514166?format=api"
}
},
{
"type": "samples",
"id": "ERS514167",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673232",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "559",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-01-27",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "ACGGGGCGCAGCAGGCGCGA, CCCGGGTATCTAATCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TAGCGC",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.29",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "4600",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "15700",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.0007",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "59000 / ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "8.6",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "4110",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514167",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater archaea",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR2A",
"sample-alias": "OL-KR2A",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514167/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514167/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514167?format=api"
}
},
{
"type": "samples",
"id": "ERS514168",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673233",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "559",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-01-27",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "AGAGTTTGATCCTGGCTCAG",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TATAGA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.29",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "4600",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "15700",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.0007",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "59000 / ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "8.6",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "4110",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514168",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater bacteria",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR2B",
"sample-alias": "OL-KR2B",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514168/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514168/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514168?format=api"
}
},
{
"type": "samples",
"id": "ERS514169",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673234",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "559",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-01-27",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "GTGTAGCAGTTACCGCA, CAACATCGTYCAYACCCAGGG",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ACTCTC",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.29",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "4600",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "15700",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.0007",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "59000 / ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "8.6",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "153939",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "4110",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514169",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater sulphate reducer",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR2D",
"sample-alias": "OL-KR2D",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514169/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514169/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514169?format=api"
}
},
{
"type": "samples",
"id": "ERS514170",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673235",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "572",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-01-26",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "ACGGGGCGCAGCAGGCGCGA, CCCGGGTATCTAATCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TACTCG",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.23",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "3700",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "14600",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.002",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "87000 / ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "3770",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514170",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater archaea",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR1A",
"sample-alias": "OL-KR1A",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514170/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514170/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514170?format=api"
}
},
{
"type": "samples",
"id": "ERS514171",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673236",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "572",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-01-26",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "AGAGTTTGATCCTGGCTCAG",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "CTGCTA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.23",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "3700",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "14600",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.002",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "87000 / ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "3770",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514171",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater bacteria",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR1B",
"sample-alias": "OL-KR1B",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514171/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514171/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514171?format=api"
}
},
{
"type": "samples",
"id": "ERS514172",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673237",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "572",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-01-26",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "GTGTAGCAGTTACCGCA, CAACATCGTYCAYACCCAGGG",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ACTATA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.23",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "3700",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "14600",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.002",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "87000 / ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "153939",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "3770",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514172",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater sulphate reducer",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR1D",
"sample-alias": "OL-KR1D",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514172/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514172/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514172?format=api"
}
},
{
"type": "samples",
"id": "ERS514173",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673238",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "572",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-01-26",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "GCMATGCARATHGGWATGTC, TGTGTGAAWCCKACDCCACC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ACTATA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.23",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "3700",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "14600",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.002",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "87000 / ml",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "198240",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "3770",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514173",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater methanogen",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR1M",
"sample-alias": "OL-KR1M",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514173/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514173/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514173?format=api"
}
},
{
"type": "samples",
"id": "ERS514174",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673239",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "798",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-05-18",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "ACGGGGCGCAGCAGGCGCGA, CCCGGGTATCTAATCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TACTCG",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.13",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "10000",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "33500",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.006",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "23000",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.3",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "7820",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514174",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater archaea",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR29A",
"sample-alias": "OL-KR29A",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514174/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514174/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514174?format=api"
}
},
{
"type": "samples",
"id": "ERS514175",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673240",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "798",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-05-18",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "AGAGTTTGATCCTGGCTCAG",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "CTGCTA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.13",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "10000",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "33500",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.006",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "23000",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.3",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "7820",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514175",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater bacteria",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR29B",
"sample-alias": "OL-KR29B",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514175/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514175/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514175?format=api"
}
},
{
"type": "samples",
"id": "ERS514176",
"attributes": {
"latitude": 61.2369,
"longitude": 21.4408,
"biosample": "SAMEA2673241",
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "DeepOlki",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "798",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-05-18",
"unit": null
},
{
"key": "source material identifiers",
"value": "groundwater",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pumping",
"unit": null
},
{
"key": "sample material processing",
"value": "concentration by filtration",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "MoBio Power water RNA extraction kit",
"unit": null
},
{
"key": "pcr primers",
"value": "GCMATGCARATHGGWATGTC, TGTGTGAAWCCKACDCCACC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ACTATA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG, CTATGCGCCTTGCCAGCCCGCTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454 Titanium",
"unit": null
},
{
"key": "alkalinity",
"value": "0.13",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "10000",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "33500",
"unit": "mg/L"
},
{
"key": "magnesium",
"value": "0.006",
"unit": "mol/L"
},
{
"key": "organism count",
"value": "23000",
"unit": null
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.3",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "198240",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "7820",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS514176",
"analysis-completed": "2017-03-14",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "Deep groundwater methanogen",
"environment-biome": "aquifer",
"environment-feature": "saline groundwater",
"environment-material": "water",
"sample-name": "OL-KR29M",
"sample-alias": "OL-KR29M",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-14T13:53:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514176/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001572",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001572?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514176/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS514176?format=api"
}
}
],
"meta": {
"pagination": {
"page": 1,
"pages": 1,
"count": 24
}
}
}