› 1qwb

Solution NMR

NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

Released:
DOI: 10.2210/pdb1qwb/pdb
PDB entry 1qwb coloured by chain, ensemble of 17 models, front view.
PDB entry 1qwb coloured by chain, ensemble of 17 models, side view.
PDB entry 1qwb coloured by chain, ensemble of 17 models, top view.
Source organism: Synthetic construct
Primary publication:
Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin.
Finger LD, Trantirek L, Johansson C, Feigon J
Nucleic Acids Res 31 6461-72 (2003)
PMID: 14602904

Function and Biology Details

Biochemical function:
  • not assigned
Biological process:
  • not assigned
Cellular component:
  • not assigned

Structure analysis Details

Assembly composition:
monomeric (preferred)
Assembly name:
PDBe Complex ID:
PDB-CPX-196181 (preferred)
Entry contents:
1 distinct RNA molecule
Macromolecule:
sNRE26 Chain: A
Molecule details ›
Chain: A
Length: 26 nucleotides
Theoretical weight: 8.37 KDa
Source organism: Synthetic construct
Expression system: Not provided

Ligands and Environments

No bound ligands
No modified residues

Experiments and Validation Details

Entry percentile scores
Refinement method: simulated annealing
Expression system: Not provided

Quick links

Citations

2 review citations

Structures, kinetics, thermodynamics, and biological functions of RNA hairpins.
Bevilacqua et al. (2008)
1 more

1 mention without citation

Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin.
Finger et al. (2003)