DNA endonuclease I-CreI
This is an endonuclease that is involved in group I intron homing. It recognises and cleavers a 19-24 bp palindromic DNA site. It is known to bind three Mg(II) ions per homodimer, it is also active with Mn(II), gives lower cleavage activity with Ni(II) and Zn(II) and no activity with Ca(II). I-CreI exists as a homodimer and the active sites of the enzyme overlap. Mg1 binds to one subunit, Mg3 binds to the other and Mg2 is bound to both. Mg2 is involved in the hydrolysis of both strands of DNA while Mg1 is involved in the hydrolysis of one strand and Mg3 the other.
Homing endonucleases do not have stringently-defined recognition sequences in the way that other restriction enzymes do. That is, single base changes do not abolish cleavage but reduce its efficiency to variable extents. The precise boundary of required bases is generally not known. The recognition sequence of one site known to be recognised and cleaved is CTGGGTTCAAAACGTCGTGAGACAGTTTGG (-10/-14).
Reference Protein and Structure
- Sequence
-
P05725
(3.1.-.-)
(Sequence Homologues)
(PDB Homologues)
- Biological species
-
Chlamydomonas reinhardtii (Green algae)
- PDB
-
1g9z
- LAGLIDADG HOMING ENDONUCLEASE I-CREI / DNA PRODUCT COMPLEX WITH MAGNESIUM
(1.8 Å)
- Catalytic CATH Domains
-
3.10.28.10
(see all for 1g9z)
- Cofactors
- Magnesium(2+) (3) Metal MACiE
Enzyme Mechanism
Introduction
Activated water, coordinated to Mg1, is the nucleophile for in-line attack on the scissile DNA phosphate. The transition state is trigonal bipyramidal. The 3'-hydroxyl leaving group coordinates to Mg2 and this favours its protonation by water. In the second step, Mg3 is active, instead of Mg1. The mechanism of this step is the same and in the cleavage of the other DNA strand.
Catalytic Residues Roles
| UniProt | PDB* (1g9z) | ||
| Asp20, Asp20, Gly19 (main-C) | Asp20(19)A(E), Asp20(19)B(F), Gly19(18)A(E) (main-C) | Involved in metal binding. | metal ligand |
Chemical Components
bimolecular nucleophilic substitution, proton transfer, hydrolysis, intermediate formation, overall reactant used, native state of enzyme regenerated, intermediate terminated, overall product formedReferences
- Chevalier B et al. (2004), Biochemistry, 43, 14015-14026. Metal-Dependent DNA Cleavage Mechanism of the I-CreI LAGLIDADG Homing Endonuclease†,‡. DOI:10.1021/bi048970c. PMID:15518550.
- Chevalier BS et al. (2001), Nat Struct Biol, 8, 312-316. The homing endonuclease I-CreI uses three metals, one of which is shared between the two active sites. DOI:10.1038/86181. PMID:11276249.
Step 1. Activated water, coordinated to Mg901, is the nucleophile for in-line attack on the scissile DNA phosphate. The transition state is trigonal bipyramidal. The 3'-hydroxyl leaving group coordinates to Mg902 and this favours its protonation by water.
Download: Image, Marvin FileCatalytic Residues Roles
| Residue | Roles |
|---|---|
| Gly19(18)A(E) (main-C) | metal ligand |
| Asp20(19)B(F) | metal ligand |
| Asp20(19)A(E) | metal ligand |
Chemical Components
ingold: bimolecular nucleophilic substitution, proton transfer, hydrolysis, intermediate formation, overall reactant used
Step 2. Activated water, coordinated to Mg903, is the nucleophile for in-line attack on the scissile phosphate of the other DNA strand. The transition state is trigonal bipyramidal. The 3'-hydroxyl leaving group coordinates to Mg902 and this favours its protonation by water.
Download: Image, Marvin FileCatalytic Residues Roles
| Residue | Roles |
|---|---|
| Gly19(18)A(E) (main-C) | metal ligand |
| Asp20(19)B(F) | metal ligand |
| Asp20(19)A(E) | metal ligand |
Download: