spacer
spacer

PDBsum entry 1kx5
Go to PDB code: 
protein dna_rna metals Protein-protein interface(s) links
Structural protein/DNA PDB id
1kx5

 

 

 

 

Loading ...

 
JSmol PyMol  
Contents
Protein chains
135 a.a. *
102 a.a. *
128 a.a. *
122 a.a. *
DNA/RNA
Metals
_MN ×14
_CL ×4
Waters ×3130
* Residue conservation analysis
PDB id:
1kx5
Name: Structural protein/DNA
Title: X-ray structure of the nucleosome core particle, ncp147, at 1.9 a resolution
Structure: DNA (5'(atcaatatccacctgcagatactaccaaaagtgtatttggaaactgctccatcaaaaggcatgtt cagctggaatccagctgaacatgccttttgatggagcagtttccaaatacacttttggtagtatctgca ggtggatattgat)3'). Chain: i. Engineered: yes. Other_details: palindromic 147 base pair DNA duplex with exception of position 0. DNA
Source: Homo sapiens. Human. Organism_taxid: 9606. Expressed in: escherichia coli. Expression_system_taxid: 562. Other_details: DNA sequence synthesized, cloned, multimerized, and excised from plasmid. Xenopus laevis. African clawed frog.
Biol. unit: Decamer (from PQS)
Resolution:
1.94Å     R-factor:   0.208     R-free:   0.275
Authors: C.A.Davey,D.F.Sargent,K.Luger,A.W.Maeder,T.J.Richmond
Key ref:
C.A.Davey et al. (2002). Solvent mediated interactions in the structure of the nucleosome core particle at 1.9 a resolution. J Mol Biol, 319, 1097-1113. PubMed id: 12079350 DOI: 10.1016/S0022-2836(02)00386-8
Date:
31-Jan-02     Release date:   25-Dec-02    
PROCHECK
Go to PROCHECK summary
 Headers
 References

Protein chains
Pfam   ArchSchema ?
P84233  (H32_XENLA) -  Histone H3.2 from Xenopus laevis
Seq:
Struc: 		136 a.a.
135 a.a.*
Protein chains
Pfam   ArchSchema ?
P62799  (H4_XENLA) -  Histone H4 from Xenopus laevis
Seq:
Struc: 		103 a.a.
102 a.a.
Protein chains
Pfam   ArchSchema ?
P06897  (H2A1_XENLA) -  Histone H2A type 1 from Xenopus laevis
Seq:
Struc: 		130 a.a.
128 a.a.*
Protein chains
Pfam   ArchSchema ?
P02281  (H2B11_XENLA) -  Histone H2B 1.1 from Xenopus laevis
Seq:
Struc: 		126 a.a.
122 a.a.*
Key:    PfamA domain  Secondary structure  CATH domain
* PDB and UniProt seqs differ at 4 residue positions (black crosses)

DNA/RNA chains
  A-T-C-A-A-T-A-T-C-C-A-C-C-T-G-C-A-G-A-T-A-C-T-A-C-C-A-A-A-A-G-T-G-T-A-T-T-T-G- 147 bases
  A-T-C-A-A-T-A-T-C-C-A-C-C-T-G-C-A-G-A-T-A-C-T-A-C-C-A-A-A-A-G-T-G-T-A-T-T-T-G- 147 bases

 

 
DOI no: 10.1016/S0022-2836(02)00386-8 J Mol Biol 319:1097-1113 (2002)
PubMed id: 12079350  
 
 
Solvent mediated interactions in the structure of the nucleosome core particle at 1.9 a resolution.
C.A.Davey, D.F.Sargent, K.Luger, A.W.Maeder, T.J.Richmond.
 
  ABSTRACT  
 
Solvent binding in the nucleosome core particle containing a 147 base pair, defined-sequence DNA is characterized from the X-ray crystal structure at 1.9 A resolution. A single-base-pair increase in DNA length over that used previously results in substantially improved clarity of the electron density and accuracy for the histone protein and DNA atomic coordinates. The reduced disorder has allowed for the first time extensive modeling of water molecules and ions. Over 3000 water molecules and 18 ions have been identified. Water molecules acting as hydrogen-bond bridges between protein and DNA are approximately equal in number to the direct hydrogen bonds between these components. Bridging water molecules have a dual role in promoting histone-DNA association not only by providing further stability to direct protein-DNA interactions, but also by enabling formation of many additional interactions between more distantly related elements. Water molecules residing in the minor groove play an important role in facilitating insertion of arginine side-chains. Water structure at the interface of the histones and DNA provides a means of accommodating intrinsic DNA conformational variation, thus limiting the sequence dependency of nucleosome positioning while enhancing mobility. Monovalent anions are bound near the N termini of histone alpha-helices that are not occluded by DNA phosphate groups. Their location in proximity to the DNA phosphodiester backbone suggests that they damp the electrostatic interaction between the histone proteins and the DNA. Divalent cations are bound at specific sites in the nucleosome core particle and contribute to histone-histone and histone-DNA interparticle interactions. These interactions may be relevant to nucleosome association in arrays.
 
  Selected figure(s)  
 
Figure 2.
Figure 2. Solvation of NCP147. (a) Water molecules and ions associated with NCP147. The view is as in Figure 1(b). Water molecules (gold) are shown as spheres of half van der Waals radius. Manganese ions (violet) and chloride ions (green) are shown as spheres of van der Waals radius. The path of the histone chains and DNA strands are shown (H3, blue; H4, green; H2A, yellow; H2B, red; DNA strands, cyan and brown). The histone N-terminal tails are not shown in their entirety. (b) Space-filling representation of the DNA and its primary hydration layer. Water molecules (gold) with centers closer than 3.5 Å from any DNA atom center are shown. The DNA superhelix (backbones strands, cyan and brown; bases, silver) is rotated 60° around the dyad axis compared to the view in (a). (c) Minor groove "spine of hydration". Five and six-member fused rings of water molecules (red) with hydrogen bonds (broken, white) are shown in the DNA minor groove with the simulated-annealing, omit difference electron density (F[o] -F[c], 1.3s contour, yellow) superimposed. 		Figure 6.
Figure 6. Specific histone-histone interparticle interactions in the NCP147 crystals. (a) Two adjacent side-chains in the histone H4 N-terminal tail, H4-R23 and H4-L22, and a Mn2+ ion (magenta) participate in extensive interactions with a highly acidic region of the H2A-H2B dimer of a neighboring nucleosome core. (b) (stereograph) A Mn2+ ion (magenta) connects H3-D77 in the H3-H4 tetramer of one particle with H2B-V45 in the H2A-H2B dimer of an adjacent particle. Both of these amino acid residues enter the coordination sphere of the divalent cation. The mean length over all six Mn2+-oxygen bonds (magenta) is 2.25 Å. Hydrogen bonds made directly between histone moieties (white) or via water molecules (yellow) are shown. (c) (stereograph) The guanidinium group of H4-R23, in a site adjacent to the Mn2+ ion of (b), makes four direct hydrogen bonds to three surrounding side-chains of the neighboring H2A-H2B dimer.
 
  The above figures are reprinted by permission from Elsevier: J Mol Biol (2002, 319, 1097-1113) copyright 2002.  
  Figures were selected by the author.  

Literature references that cite this PDB file's key reference

  PubMed id Reference
22722606 K.Luger, M.L.Dechassa, and D.J.Tremethick (2012).
New insights into nucleosome and chromatin structure: an ordered state or a disordered affair?
  Nat Rev Mol Cell Biol, 13, 436-447.  
22334143 L.Davis, and J.W.Chin (2012).
Designer proteins: applications of genetic code expansion in cell biology.
  Nat Rev Mol Cell Biol, 13, 168-182.  
21047799 A.Allahverdi, R.Yang, N.Korolev, Y.Fan, C.A.Davey, C.F.Liu, and L.Nordenskiöld (2011).
The effects of histone H4 tail acetylations on cation-induced chromatin folding and self-association.
  Nucleic Acids Res, 39, 1680-1691.  
21332355 A.J.Andrews, and K.Luger (2011).
Nucleosome structure(s) and stability: variations on a theme.
  Annu Rev Biophys, 40, 99.  
21208404 A.Marathe, and M.Bansal (2011).
An ensemble of B-DNA dinucleotide geometries lead to characteristic nucleosomal DNA structure and provide plasticity required for gene expression.
  BMC Struct Biol, 11, 1.  
21344528 B.Wu, M.S.Ong, M.Groessl, Z.Adhireksan, C.G.Hartinger, P.J.Dyson, and C.A.Davey (2011).
A ruthenium antimetastasis agent forms specific histone protein adducts in the nucleosome core.
  Chemistry, 17, 3562-3566.
PDB code: 3mnn
21157623 D.Yang, and G.Arya (2011).
Structure and binding of the H4 histone tail and the effects of lysine 16 acetylation.
  Phys Chem Chem Phys, 13, 2911-2921.  
  21410646 F.J.Blanco, and G.Montoya (2011).
Transient DNA / RNA-protein interactions.
  FEBS J, 278, 1643-1650.  
  21135411 G.A.Babbitt, and C.R.Cotter (2011).
Functional conservation of nucleosome formation selectively biases presumably neutral molecular variation in yeast genomes.
  Genome Biol Evol, 3, 15-22.  
21984211 J.R.Chittuluru, Y.Chaban, J.Monnet-Saksouk, M.J.Carrozza, V.Sapountzi, W.Selleck, J.Huang, R.T.Utley, M.Cramet, S.Allard, G.Cai, J.L.Workman, M.G.Fried, S.Tan, J.Côté, and F.J.Asturias (2011).
Structure and nucleosome interaction of the yeast NuA4 and Piccolo-NuA4 histone acetyltransferase complexes.
  Nat Struct Mol Biol, 18, 1196-1203.  
21249157 K.E.Gardner, L.Zhou, M.A.Parra, X.Chen, and B.D.Strahl (2011).
Identification of lysine 37 of histone H2B as a novel site of methylation.
  PLoS One, 6, e16244.  
21525927 K.Yamada, T.D.Frouws, B.Angst, D.J.Fitzgerald, C.DeLuca, K.Schimmele, D.F.Sargent, and T.J.Richmond (2011).
Structure and mechanism of the chromatin remodelling factor ISW1a.
  Nature, 472, 448-453.
PDB codes: 2y9y 2y9z
20972223 M.Ghorbani, and F.Mohammad-Rafiee (2011).
Geometrical correlations in the nucleosomal DNA conformation and the role of the covalent bonds rigidity.
  Nucleic Acids Res, 39, 1220-1230.  
  21538665 M.Nevels, A.Nitzsche, and C.Paulus (2011).
How to control an infectious bead string: nucleosome-based regulation and targeting of herpesvirus chromatin.
  Rev Med Virol, 21, 154-180.  
21243712 P.Voigt, and D.Reinberg (2011).
Histone tails: ideal motifs for probing epigenetics through chemical biology approaches.
  Chembiochem, 12, 236-252.  
21176878 S.Tan, and C.A.Davey (2011).
Nucleosome structural studies.
  Curr Opin Struct Biol, 21, 128-136.  
21226976 T.Schlick, R.Collepardo-Guevara, L.A.Halvorsen, S.Jung, and X.Xiao (2011).
Biomolecularmodeling and simulation: a field coming of age.
  Q Rev Biophys, 44, 191-228.  
21177647 V.Böhm, A.R.Hieb, A.J.Andrews, A.Gansen, A.Rocker, K.Tóth, K.Luger, and J.Langowski (2011).
Nucleosome accessibility governed by the dimer/tetramer interface.
  Nucleic Acids Res, 39, 3093-3102.  
20520775 A.Aslam, and C.Logie (2010).
Histone H3 serine 57 and lysine 56 interplay in transcription elongation and recovery from S-phase stress.
  PLoS One, 5, e10851.  
19888548 A.De Marco, P.D.Dans, A.Knezevich, P.Maiuri, S.Pantano, and A.Marcello (2010).
Subcellular localization of the interaction between the human immunodeficiency virus transactivator Tat and the nucleosome assembly protein 1.
  Amino Acids, 38, 1583-1593.  
  20232928 A.Travers, E.Hiriart, M.Churcher, M.Caserta, and E.Di Mauro (2010).
The DNA sequence-dependence of nucleosome positioning in vivo and in vitro.
  J Biomol Struct Dyn, 27, 713-724.  
19920127 B.Heddi, C.Oguey, C.Lavelle, N.Foloppe, and B.Hartmann (2010).
Intrinsic flexibility of B-DNA: the experimental TRX scale.
  Nucleic Acids Res, 38, 1034-1047.  
20399189 B.Wu, K.Mohideen, D.Vasudevan, and C.A.Davey (2010).
Structural insight into the sequence dependence of nucleosome positioning.
  Structure, 18, 528-536.
PDB code: 3lel
20449491 C.Butchosa, S.Simon, and A.A.Voityuk (2010).
Electron transfer from aromatic amino acids to guanine and adenine radical cations in pi stacked and T-shaped complexes.
  Org Biomol Chem, 8, 1870-1875.  
20462404 C.Hebert, and H.Roest Crollius (2010).
Nucleosome rotational setting is associated with transcriptional regulation in promoters of tissue-specific human genes.
  Genome Biol, 11, R51.  
21209967 C.Oguey, N.Foloppe, and B.Hartmann (2010).
Understanding the sequence-dependence of DNA groove dimensions: implications for DNA interactions.
  PLoS One, 5, e15931.  
21170357 C.Vogler, C.Huber, T.Waldmann, R.Ettig, L.Braun, A.Izzo, S.Daujat, I.Chassignet, A.J.Lopez-Contreras, O.Fernandez-Capetillo, M.Dundr, K.Rippe, G.Längst, and R.Schneider (2010).
Histone H2A C-terminus regulates chromatin dynamics, remodeling, and histone H1 binding.
  PLoS Genet, 6, e1001234.  
20232937 D.Wang, N.B.Ulyanov, and V.B.Zhurkin (2010).
Sequence-dependent Kink-and-Slide deformations of nucleosomal DNA facilitated by histone arginines bound in the minor groove.
  J Biomol Struct Dyn, 27, 843-859.  
  20232936 F.Cui, and V.B.Zhurkin (2010).
Structure-based analysis of DNA sequence patterns guiding nucleosome positioning in vitro.
  J Biomol Struct Dyn, 27, 821-841.  
20647418 F.Xu, A.V.Colasanti, Y.Li, and W.K.Olson (2010).
Long-range effects of histone point mutations on DNA remodeling revealed from computational analyses of SIN-mutant nucleosome structures.
  Nucleic Acids Res, 38, 6872-6882.  
20026584 G.E.Davey, B.Wu, Y.Dong, U.Surana, and C.A.Davey (2010).
DNA stretching in the nucleosome facilitates alkylation by an intercalating antitumour agent.
  Nucleic Acids Res, 38, 2081-2088.
PDB code: 3kuy
19887449 G.Sahu, D.Wang, C.B.Chen, V.B.Zhurkin, R.E.Harrington, E.Appella, G.L.Hager, and A.K.Nagaich (2010).
p53 binding to nucleosomal DNA depends on the rotational positioning of DNA response element.
  J Biol Chem, 285, 1321-1332.  
20156997 H.Hashimoto, Y.Takami, E.Sonoda, T.Iwasaki, H.Iwano, M.Tachibana, S.Takeda, T.Nakayama, H.Kimura, and Y.Shinkai (2010).
Histone H1 null vertebrate cells exhibit altered nucleosome architecture.
  Nucleic Acids Res, 38, 3533-3545.  
20005182 I.D.Odell, K.Newick, N.H.Heintz, S.S.Wallace, and D.S.Pederson (2010).
Non-specific DNA binding interferes with the efficient excision of oxidative lesions from chromatin by the human DNA glycosylase, NEIL1.
  DNA Repair (Amst), 9, 134-143.  
20106816 I.Gabdank, D.Barash, and E.N.Trifonov (2010).
FineStr: a web server for single-base-resolution nucleosome positioning.
  Bioinformatics, 26, 845-846.  
21081084 I.V.Dobrovolskaia, M.Kenward, and G.Arya (2010).
Twist propagation in dinucleosome arrays.
  Biophys J, 99, 3355-3364.  
20713519 J.Govin, J.Dorsey, J.Gaucher, S.Rousseaux, S.Khochbin, and S.L.Berger (2010).
Systematic screen reveals new functional dynamics of histones H3 and H4 during gametogenesis.
  Genes Dev, 24, 1772-1786.  
20176960 J.M.Hinz, Y.Rodriguez, and M.J.Smerdon (2010).
Rotational dynamics of DNA on the nucleosome surface markedly impact accessibility to a DNA repair enzyme.
  Proc Natl Acad Sci U S A, 107, 4646-4651.  
21149689 J.T.Sczepanski, R.S.Wong, J.N.McKnight, G.D.Bowman, and M.M.Greenberg (2010).
Rapid DNA-protein cross-linking and strand scission by an abasic site in a nucleosome core particle.
  Proc Natl Acad Sci U S A, 107, 22475-22480.  
20494975 K.Mohideen, R.Muhammad, and C.A.Davey (2010).
Perturbations in nucleosome structure from heavy metal association.
  Nucleic Acids Res, 38, 6301-6311.
PDB codes: 3mgp 3mgq 3mgr 3mgs
20201649 M.A.du Penhoat, A.Eschenbrenner, F.Abel, A.Boissiere, J.M.Guigner, A.Chetioui, M.F.Politis, A.Touati, E.Sage, T.J.Jenner, D.L.Stevens, and M.A.Hill (2010).
Double-strand break induction and repair in V79-4 hamster cells: the role of core ionisations, as probed by ultrasoft X-rays.
  Int J Radiat Biol, 86, 205-219.  
20131086 M.Dalvai, and K.Bystricky (2010).
The role of histone modifications and variants in regulating gene expression in breast cancer.
  J Mammary Gland Biol Neoplasia, 15, 19-33.  
20562439 M.R.Duan, and M.J.Smerdon (2010).
UV damage in DNA promotes nucleosome unwrapping.
  J Biol Chem, 285, 26295-26303.  
19758583 N.Korolev, A.P.Lyubartsev, and L.Nordenskiöld (2010).
Cation-induced polyelectrolyte-polyelectrolyte attraction in solutions of DNA and nucleosome core particles.
  Adv Colloid Interface Sci, 158, 32-47.  
20739937 N.Sekulic, E.A.Bassett, D.J.Rogers, and B.E.Black (2010).
The structure of (CENP-A-H4)(2) reveals physical features that mark centromeres.
  Nature, 467, 347-351.
PDB codes: 3nqj 3nqu
  20537131 P.M.Diesinger, and D.W.Heermann (2010).
Monte Carlo Simulations indicate that Chromati: Nanostructure is accessible by Light Microscopy.
  PMC Biophys, 3, 11.  
20215439 P.Várnai, and Y.Timsit (2010).
Differential stability of DNA crossovers in solution mediated by divalent cations.
  Nucleic Acids Res, 38, 4163-4172.  
21168769 R.C.Todd, and S.J.Lippard (2010).
Consequences of cisplatin binding on nucleosome structure and dynamics.
  Chem Biol, 17, 1334-1343.
PDB code: 3o62
20739938 R.D.Makde, J.R.England, H.P.Yennawar, and S.Tan (2010).
Structure of RCC1 chromatin factor bound to the nucleosome core particle.
  Nature, 467, 562-566.
PDB code: 3mvd
20133639 R.Karlić, H.R.Chung, J.Lasserre, K.Vlahovicek, and M.Vingron (2010).
Histone modification levels are predictive for gene expression.
  Proc Natl Acad Sci U S A, 107, 2926-2931.  
20007597 R.Nag, M.Kyriss, J.W.Smerdon, J.J.Wyrick, and M.J.Smerdon (2010).
A cassette of N-terminal amino acids of histone H2B are required for efficient cell survival, DNA repair and Swi/Snf binding in UV irradiated yeast.
  Nucleic Acids Res, 38, 1450-1460.  
19705140 S.G.Gu, and A.Fire (2010).
Partitioning the C. elegans genome by nucleosome modification, occupancy, and positioning.
  Chromosoma, 119, 73-87.  
20371521 S.Ishihara, R.Varma, and R.H.Schwartz (2010).
A new fractionation assay, based on the size of formaldehyde-crosslinked, mildly sheared chromatin, delineates the chromatin structure at promoter regions.
  Nucleic Acids Res, 38, e124.  
20628623 S.M.Reynolds, J.A.Bilmes, and W.S.Noble (2010).
Learning a weighted sequence model of the nucleosome core and linker yields more accurate predictions in Saccharomyces cerevisiae and Homo sapiens.
  PLoS Comput Biol, 6, e1000834.  
20232938 S.M.West, R.Rohs, R.S.Mann, and B.Honig (2010).
Electrostatic interactions between arginines and the minor groove in the nucleosome.
  J Biomol Struct Dyn, 27, 861-866.  
20819935 S.M.Wiedemann, S.N.Mildner, C.Bönisch, L.Israel, A.Maiser, S.Matheisl, T.Straub, R.Merkl, H.Leonhardt, E.Kremmer, L.Schermelleh, and S.B.Hake (2010).
Identification and characterization of two novel primate-specific histone H3 variants, H3.X and H3.Y.
  J Cell Biol, 190, 777-791.  
20525793 S.Messner, M.Altmeyer, H.Zhao, A.Pozivil, B.Roschitzki, P.Gehrig, D.Rutishauser, D.Huang, A.Caflisch, and M.O.Hottiger (2010).
PARP1 ADP-ribosylates lysine residues of the core histone tails.
  Nucleic Acids Res, 38, 6350-6362.  
  20808881 W.Möbius, and U.Gerland (2010).
Quantitative test of the barrier nucleosome model for statistical positioning of nucleosomes up- and downstream of transcription start sites.
  PLoS Comput Biol, 6, 0.  
19706432 A.Gansen, A.Valeri, F.Hauger, S.Felekyan, S.Kalinin, K.Tóth, J.Langowski, and C.A.Seidel (2009).
Nucleosome disassembly intermediates characterized by single-molecule FRET.
  Proc Natl Acad Sci U S A, 106, 15308-15313.  
19259559 A.M.Nunes, K.Zavitsanos, R.Del Conte, G.Malandrinos, and N.Hadjiliadis (2009).
Interaction of histone H2B (fragment 63-93) with Ni(ii). An NMR study.
  Dalton Trans, (), 1904-1913.  
19393049 A.Marathe, D.Karandur, and M.Bansal (2009).
Small local variations in B-form DNA lead to a large variety of global geometries which can accommodate most DNA-binding protein motifs.
  BMC Struct Biol, 9, 24.  
19472233 A.Perico, and A.Ciferri (2009).
The supramolecular association of polyelectrolytes to complementary charged surfactants and protein assemblies.
  Chemistry, 15, 6312-6320.  
19394329 A.Rabbani-Chadegani, E.Chamani, and Z.Hajihassan (2009).
The effect of vinca alkaloid anticancer drug, vinorelbine, on chromatin and histone proteins in solution.
  Eur J Pharmacol, 613, 34-38.  
  20161589 B.A.Julian, H.Suzuki, Y.Suzuki, Y.Tomino, G.Spasovski, and J.Novak (2009).
Sources of Urinary Proteins and their Analysis by Urinary Proteomics for the Detection of Biomarkers of Disease.
  Proteomics Clin Appl, 3, 1029-1043.  
19898522 B.Pérez-Cadahía, B.Drobic, and J.R.Davie (2009).
H3 phosphorylation: dual role in mitosis and interphase.
  Biochem Cell Biol, 87, 695-709.  
19204718 C.Jiang, and B.F.Pugh (2009).
Nucleosome positioning and gene regulation: advances through genomics.
  Nat Rev Genet, 10, 161-172.  
19385041 D.F.Hansen, Z.Zhou, H.Feng, L.M.Miller Jenkins, Y.Bai, and L.E.Kay (2009).
Binding kinetics of histone chaperone Chz1 and variant histone H2A.Z-H2B by relaxation dispersion NMR spectroscopy.
  J Mol Biol, 387, 1-9.  
19886812 E.I.Campos, and D.Reinberg (2009).
Histones: annotating chromatin.
  Annu Rev Genet, 43, 559-599.  
19282449 F.Cui, and V.B.Zhurkin (2009).
Distinctive sequence patterns in metazoan and yeast nucleosomes: implications for linker histone binding to AT-rich and methylated DNA.
  Nucleic Acids Res, 37, 2818-2829.  
19943916 F.Pedone, and D.Santoni (2009).
Sequence-dependent DNA helical rise and nucleosome stability.
  BMC Mol Biol, 10, 105.  
19298048 G.Arya, and T.Schlick (2009).
A tale of tails: how histone tails mediate chromatin compaction in different salt and linker histone environments.
  J Phys Chem A, 113, 4045-4059.  
19474339 G.Zheng, X.J.Lu, and W.K.Olson (2009).
Web 3DNA--a web server for the analysis, reconstruction, and visualization of three-dimensional nucleic-acid structures.
  Nucleic Acids Res, 37, W240-W246.  
19818718 H.Neumann, S.M.Hancock, R.Buning, A.Routh, L.Chapman, J.Somers, T.Owen-Hughes, J.van Noort, D.Rhodes, and J.W.Chin (2009).
A method for genetically installing site-specific acetylation in recombinant histones defines the effects of H3 K56 acetylation.
  Mol Cell, 36, 153-163.  
19877003 H.Wong, P.J.Winn, and J.Mozziconacci (2009).
A molecular model of chromatin organisation and transcription: how a multi-RNA polymerase II machine transcribes and remodels the beta-globin locus during development.
  Bioessays, 31, 1357-1366.  
19234531 H.Yang, and C.A.Mizzen (2009).
The multiple facets of histone H4-lysine 20 methylation.
  Biochem Cell Biol, 87, 151-161.  
19880310 J.C.Lucchesi (2009).
The structure-function link of compensated chromatin in Drosophila.
  Curr Opin Genet Dev, 19, 550-556.  
19234530 J.K.Choi, and L.J.Howe (2009).
Histone acetylation: truth of consequences?
  Biochem Cell Biol, 87, 139-150.  
19217387 J.Zlatanova, T.C.Bishop, J.M.Victor, V.Jackson, and K.van Holde (2009).
The nucleosome family: dynamic and growing.
  Structure, 17, 160-171.  
19779690 K.B.Falbo, and X.Shen (2009).
Histone modifications during DNA replication.
  Mol Cells, 28, 149-154.  
  19652528 K.Bandyopadhyay, J.L.Banères, A.Martin, C.Blonski, J.Parello, and R.A.Gjerset (2009).
Spermidinyl-CoA-based HAT inhibitors block DNA repair and provide cancer-specific chemo- and radiosensitization.
  Cell Cycle, 8, 2779-2788.  
19234540 L.Zhang, K.Jones, and F.Gong (2009).
The molecular basis of chromatin dynamics during nucleotide excision repair.
  Biochem Cell Biol, 87, 265-272.  
19136959 M.A.Hall, A.Shundrovsky, L.Bai, R.M.Fulbright, J.T.Lis, and M.D.Wang (2009).
High-resolution dynamic mapping of histone-DNA interactions in a nucleosome.
  Nat Struct Mol Biol, 16, 124-129.  
19571359 M.Emanuel, N.H.Radja, A.Henriksson, and H.Schiessel (2009).
The physics behind the larger scale organization of DNA in eukaryotes.
  Phys Biol, 6, 25008.  
19182801 M.Engeholm, M.de Jager, A.Flaus, R.Brenk, J.van Noort, and T.Owen-Hughes (2009).
Nucleosomes can invade DNA territories occupied by their neighbors.
  Nat Struct Mol Biol, 16, 151-158.  
19246569 M.Y.Tolstorukov, P.V.Kharchenko, J.A.Goldman, R.E.Kingston, and P.J.Park (2009).
Comparative analysis of H2A.Z nucleosome organization in the human and yeast genomes.
  Genome Res, 19, 967-977.  
19368891 N.B.Becker, and R.Everaers (2009).
DNA nanomechanics in the nucleosome.
  Structure, 17, 579-589.  
19843447 P.M.Diesinger, and D.W.Heermann (2009).
Depletion effects massively change chromatin properties and influence genome folding.
  Biophys J, 97, 2146-2153.  
19001093 P.Y.Kan, T.L.Caterino, and J.J.Hayes (2009).
The H4 tail domain participates in intra- and internucleosome interactions with protein and DNA during folding and oligomerization of nucleosome arrays.
  Mol Cell Biol, 29, 538-546.  
  19799466 R.K.McGinty, M.Köhn, C.Chatterjee, K.P.Chiang, M.R.Pratt, and T.W.Muir (2009).
Structure-activity analysis of semisynthetic nucleosomes: mechanistic insights into the stimulation of Dot1L by ubiquitylated histone H2B.
  ACS Chem Biol, 4, 958-968.  
19865164 R.Rohs, S.M.West, A.Sosinsky, P.Liu, R.S.Mann, and B.Honig (2009).
The role of DNA shape in protein-DNA recognition.
  Nature, 461, 1248-1253.  
19289051 S.Balasubramanian, F.Xu, and W.K.Olson (2009).
DNA sequence-directed organization of chromatin: structure-based computational analysis of nucleosome-binding sequences.
  Biophys J, 96, 2245-2260.  
19561610 S.Daujat, T.Weiss, F.Mohn, U.C.Lange, C.Ziegler-Birling, U.Zeissler, M.Lappe, D.Schübeler, M.E.Torres-Padilla, and R.Schneider (2009).
H3K64 trimethylation marks heterochromatin and is dynamically remodeled during developmental reprogramming.
  Nat Struct Mol Biol, 16, 777-781.  
19160459 S.Healy, T.D.Heightman, L.Hohmann, D.Schriemer, and R.A.Gravel (2009).
Nonenzymatic biotinylation of histone H2A.
  Protein Sci, 18, 314-328.  
19236904 S.Kundu, and C.L.Peterson (2009).
Role of chromatin states in transcriptional memory.
  Biochim Biophys Acta, 1790, 445-455.  
19218239 S.Li, and M.A.Shogren-Knaak (2009).
The Gcn5 bromodomain of the SAGA complex facilitates cooperative and cross-tail acetylation of nucleosomes.
  J Biol Chem, 284, 9411-9417.  
19834459 U.Braunschweig, G.J.Hogan, L.Pagie, and B.van Steensel (2009).
Histone H1 binding is inhibited by histone variant H3.3.
  EMBO J, 28, 3635-3645.  
19289035 Y.Yang, A.P.Lyubartsev, N.Korolev, and L.Nordenskiöld (2009).
Computer modeling reveals that modifications of the histone tail charges define salt-dependent interaction of the nucleosome core particles.
  Biophys J, 96, 2082-2094.  
18583476 A.Routh, S.Sandin, and D.Rhodes (2008).
Nucleosome repeat length and linker histone stoichiometry determine chromatin fiber structure.
  Proc Natl Acad Sci U S A, 105, 8872-8877.  
18477713 A.Valouev, J.Ichikawa, T.Tonthat, J.Stuart, S.Ranade, H.Peckham, K.Zeng, J.A.Malek, G.Costa, K.McKernan, A.Sidow, A.Fire, and S.M.Johnson (2008).
A high-resolution, nucleosome position map of C. elegans reveals a lack of universal sequence-dictated positioning.
  Genome Res, 18, 1051-1063.  
18940663 B.Wu, and C.A.Davey (2008).
Platinum drug adduct formation in the nucleosome core alters nucleosome mobility but not positioning.
  Chem Biol, 15, 1023-1028.  
18157123 B.Wu, P.Dröge, and C.A.Davey (2008).
Site selectivity of platinum anticancer therapeutics.
  Nat Chem Biol, 4, 110-112.
PDB codes: 3b6f 3b6g
18806873 C.B.Gocke, and H.Yu (2008).
ZNF198 stabilizes the LSD1-CoREST-HDAC1 complex on chromatin through its MYM-type zinc fingers.
  PLoS ONE, 3, e3255.  
17957772 C.R.Clapier, S.Chakravarthy, C.Petosa, C.Fernández-Tornero, K.Luger, and C.W.Müller (2008).
Structure of the Drosophila nucleosome core particle highlights evolutionary constraints on the H2A-H2B histone dimer.
  Proteins, 71, 1-7.
PDB code: 2pyo
18477633 D.Svozil, J.Kalina, M.Omelka, and B.Schneider (2008).
DNA conformations and their sequence preferences.
  Nucleic Acids Res, 36, 3690-3706.  
17934746 D.Z.Staynov, and Y.G.Proykova (2008).
Topological constraints on the possible structures of the 30 nm chromatin fibre.
  Chromosoma, 117, 67-76.  
18549451 D.Z.Staynov, and Y.G.Proykova (2008).
The sequentiallity of nucleosomes in the 30 nm chromatin fibre.
  FEBS J, 275, 3761-3771.  
18798528 D.Z.Staynov (2008).
The controversial 30 nm chromatin fibre.
  Bioessays, 30, 1003-1009.  
18924284 G.E.Davey, and C.A.Davey (2008).
Chromatin - a new, old drug target?
  Chem Biol Drug Des, 72, 165-170.  
18156683 H.B.Stuhrmann (2008).
Small-angle scattering and its interplay with crystallography, contrast variation in SAXS and SANS.
  Acta Crystallogr A, 64, 181-191.  
18192367 H.Liu, and Y.Duan (2008).
Effects of posttranslational modifications on the structure and dynamics of histone H3 N-terminal Peptide.
  Biophys J, 94, 4579-4585.  
18237740 K.A.Vander Meulen, R.M.Saecker, and M.T.Record (2008).
Formation of a wrapped DNA-protein interface: experimental characterization and analysis of the large contributions of ions and water to the thermodynamics of binding IHF to H' DNA.
  J Mol Biol, 377, 9.  
18339542 L.R.Racki, and G.J.Narlikar (2008).
ATP-dependent chromatin remodeling enzymes: two heads are not better, just different.
  Curr Opin Genet Dev, 18, 137-144.  
18292856 M.A.Berg, R.S.Coleman, and C.J.Murphy (2008).
Nanoscale structure and dynamics of DNA.
  Phys Chem Chem Phys, 10, 1229-1242.  
18644858 M.L.Dechassa, B.Zhang, R.Horowitz-Scherer, J.Persinger, C.L.Woodcock, C.L.Peterson, and B.Bartholomew (2008).
Architecture of the SWI/SNF-nucleosome complex.
  Mol Cell Biol, 28, 6010-6021.  
18327589 M.L.Evans, L.J.Bostelman, A.M.Albrecht, A.M.Keller, N.T.Strande, and J.S.Thompson (2008).
UV sensitive mutations in histone H3 in Saccharomyces cerevisiae that alter specific K79 methylation states genetically act through distinct DNA repair pathways.
  Curr Genet, 53, 259-274.  
18676809 M.L.Kilkenny, A.S.Doré, S.M.Roe, K.Nestoras, J.C.Ho, F.Z.Watts, and L.H.Pearl (2008).
Structural and functional analysis of the Crb2-BRCT2 domain reveals distinct roles in checkpoint signaling and DNA damage repair.
  Genes Dev, 22, 2034-2047.
PDB codes: 2vxb 2vxc
18976667 M.R.Stump, and L.M.Gloss (2008).
Mutational analysis of the stability of the H2A and H2B histone monomers.
  J Mol Biol, 384, 1369-1383.  
18571423 N.V.Murzina, X.Y.Pei, W.Zhang, M.Sparkes, J.Vicente-Garcia, J.V.Pratap, S.H.McLaughlin, T.R.Ben-Shahar, A.Verreault, B.F.Luisi, and E.D.Laue (2008).
Structural basis for the recognition of histone H4 by the histone-chaperone RbAp46.
  Structure, 16, 1077-1085.
PDB codes: 3cfs 3cfv
18234821 P.M.Diesinger, and D.W.Heermann (2008).
The influence of the cylindrical shape of the nucleosomes and H1 defects on properties of chromatin.
  Biophys J, 94, 4165-4172.  
18723689 P.V.Kharchenko, C.J.Woo, M.Y.Tolstorukov, R.E.Kingston, and P.J.Park (2008).
Nucleosome positioning in human HOX gene clusters.
  Genome Res, 18, 1554-1561.  
18658212 R.Stehr, N.Kepper, K.Rippe, and G.Wedemann (2008).
The effect of internucleosomal interaction on folding of the chromatin fiber.
  Biophys J, 95, 3677-3691.  
18461484 S.H.Leuba, S.P.Anand, J.M.Harp, and S.A.Khan (2008).
Expedient placement of two fluorescent dyes for investigating dynamic DNA protein interactions in real time.
  Chromosome Res, 16, 451-467.  
18072184 S.Orthaus, C.Biskup, B.Hoffmann, C.Hoischen, S.Ohndorf, K.Benndorf, and S.Diekmann (2008).
Assembly of the inner kinetochore proteins CENP-A and CENP-B in living human cells.
  Chembiochem, 9, 77-92.  
18424496 T.C.Bishop (2008).
Geometry of the nucleosomal DNA superhelix.
  Biophys J, 95, 1007-1017.  
18186481 T.Yamane, H.Okamura, M.Ikeguchi, Y.Nishimura, and A.Kidera (2008).
Water-mediated interactions between DNA and PhoB DNA-binding/transactivation domain: NMR-restrained molecular dynamics in explicit water environment.
  Proteins, 71, 1970-1983.
PDB code: 2z33
18484631 V.Andrushchenko, and P.Bour (2008).
Circular dichroism enhancement in large DNA aggregates simulated by a generalized oscillator model.
  J Comput Chem, 29, 2693-2703.  
18600227 X.J.Lu, and W.K.Olson (2008).
3DNA: a versatile, integrated software system for the analysis, rebuilding and visualization of three-dimensional nucleic-acid structures.
  Nat Protoc, 3, 1213-1227.  
18794842 X.Lu, M.D.Simon, J.V.Chodaparambil, J.C.Hansen, K.M.Shokat, and K.Luger (2008).
The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure.
  Nat Struct Mol Biol, 15, 1122-1124.
PDB codes: 3c1b 3c1c
17882413 A.Bertin, D.Durand, M.Renouard, F.Livolant, and S.Mangenot (2007).
H2A and H2B tails are essential to properly reconstitute nucleosome core particles.
  Eur Biophys J, 36, 1083-1094.  
17237203 A.Bertin, M.Renouard, J.S.Pedersen, F.Livolant, and D.Durand (2007).
H3 and H4 histone tails play a central role in the interactions of recombinant NCPs.
  Biophys J, 92, 2633-2645.  
17693471 A.Bertin, S.Mangenot, M.Renouard, D.Durand, and F.Livolant (2007).
Structure and phase diagram of nucleosome core particles aggregated by multivalent cations.
  Biophys J, 93, 3652-3663.  
17320509 A.Groth, W.Rocha, A.Verreault, and G.Almouzni (2007).
Chromatin challenges during DNA replication and repair.
  Cell, 128, 721-733.  
17439730 A.Rabbani, S.Abdosamadi, and N.Sari-Saraf (2007).
Affinity of anticancer drug, daunomycin, to core histones in solution: comparison of free and cross-linked proteins.
  Acta Pharmacol Sin, 28, 731-737.  
17227890 A.Sakaguchi, and R.Steward (2007).
Aberrant monomethylation of histone H4 lysine 20 activates the DNA damage checkpoint in Drosophila melanogaster.
  J Cell Biol, 176, 155-162.  
17360341 B.E.Black, M.A.Brock, S.Bédard, V.L.Woods, and D.W.Cleveland (2007).
An epigenetic mark generated by the incorporation of CENP-A into centromeric nucleosomes.
  Proc Natl Acad Sci U S A, 104, 5008-5013.  
17369611 B.Xhemalce, K.M.Miller, R.Driscoll, H.Masumoto, S.P.Jackson, T.Kouzarides, A.Verreault, and B.Arcangioli (2007).
Regulation of histone H3 lysine 56 acetylation in Schizosaccharomyces pombe.
  J Biol Chem, 282, 15040-15047.  
17597150 D.A.Hoch, J.J.Stratton, and L.M.Gloss (2007).
Protein-protein Förster resonance energy transfer analysis of nucleosome core particles containing H2A and H2A.Z.
  J Mol Biol, 371, 971-988.  
17252562 D.Roccatano, A.Barthel, and M.Zacharias (2007).
Structural flexibility of the nucleosome core particle at atomic resolution studied by molecular dynamics simulation.
  Biopolymers, 85, 407-421.  
17545981 D.Shechter, H.L.Dormann, C.D.Allis, and S.B.Hake (2007).
Extraction, purification and analysis of histones.
  Nat Protoc, 2, 1445-1457.  
17468167 F.Montel, E.Fontaine, P.St-Jean, M.Castelnovo, and C.Faivre-Moskalenko (2007).
Atomic force microscopy imaging of SWI/SNF action: mapping the nucleosome remodeling and sliding.
  Biophys J, 93, 566-578.  
17387148 H.Ferreira, J.Somers, R.Webster, A.Flaus, and T.Owen-Hughes (2007).
Histone tails and the H3 alphaN helix regulate nucleosome mobility and stability.
  Mol Cell Biol, 27, 4037-4048.  
17103419 H.G.Garcia, P.Grayson, L.Han, M.Inamdar, J.Kondev, P.C.Nelson, R.Phillips, J.Widom, and P.A.Wiggins (2007).
Biological consequences of tightly bent DNA: the other life of a macromolecular celebrity.
  Biopolymers, 85, 115-130.  
17849006 H.Wong, J.M.Victor, and J.Mozziconacci (2007).
An all-atom model of the chromatin fiber containing linker histones reveals a versatile structure tuned by the nucleosomal repeat length.
  PLoS ONE, 2, e877.  
17309845 H.Zheng, L.S.Goldner, and S.H.Leuba (2007).
Homebuilt single-molecule scanning confocal fluorescence microscope studies of single DNA/protein interactions.
  Methods, 41, 342-352.  
17084454 I.Neeli, M.M.Richardson, S.N.Khan, D.Nicolo, M.Monestier, and M.Z.Radic (2007).
Divergent members of a single autoreactive B cell clone retain specificity for apoptotic blebs.
  Mol Immunol, 44, 1914-1921.  
17309839 J.G.Yang, and G.J.Narlikar (2007).
FRET-based methods to study ATP-dependent changes in chromatin structure.
  Methods, 41, 291-295.  
17521420 J.L.Jiménez, B.Hegemann, J.R.Hutchins, J.M.Peters, and R.Durbin (2007).
A systematic comparative and structural analysis of protein phosphorylation sites based on the mtcPTM database.
  Genome Biol, 8, R90.  
17936653 J.Langowski, and D.W.Heermann (2007).
Computational modeling of the chromatin fiber.
  Semin Cell Dev Biol, 18, 659-667.  
17905614 K.van Holde, and J.Zlatanova (2007).
Chromatin fiber structure: Where is the problem now?
  Semin Cell Dev Biol, 18, 651-658.  
17330872 L.Arcesi, G.La Penna, and A.Perico (2007).
Generalized electrostatic model of the wrapping of DNA around oppositely charged proteins.
  Biopolymers, 86, 127-135.  
17503032 M.Bussiek, G.Müller, W.Waldeck, S.Diekmann, and J.Langowski (2007).
Organisation of nucleosomal arrays reconstituted with repetitive African green monkey alpha-satellite DNA as analysed by atomic force microscopy.
  Eur Biophys J, 37, 81-93.  
18033877 M.Nakata, G.Zanchetta, B.D.Chapman, C.D.Jones, J.O.Cross, R.Pindak, T.Bellini, and N.A.Clark (2007).
End-to-end stacking and liquid crystal condensation of 6 to 20 base pair DNA duplexes.
  Science, 318, 1276-1279.  
18158331 M.Tardat, R.Murr, Z.Herceg, C.Sardet, and E.Julien (2007).
PR-Set7-dependent lysine methylation ensures genome replication and stability through S phase.
  J Cell Biol, 179, 1413-1426.  
17585938 M.Y.Tolstorukov, A.V.Colasanti, D.M.McCandlish, W.K.Olson, and V.B.Zhurkin (2007).
A novel roll-and-slide mechanism of DNA folding in chromatin: implications for nucleosome positioning.
  J Mol Biol, 371, 725-738.  
17471473 N.Korolev, and L.Nordenskiöld (2007).
H4 histone tail mediated DNA-DNA interaction and effects on DNA structure, flexibility, and counterion binding: a molecular dynamics study.
  Biopolymers, 86, 409-423.  
17875941 R.Yokoyama, A.Pannuti, H.Ling, E.R.Smith, and J.C.Lucchesi (2007).
A plasmid model system shows that Drosophila dosage compensation depends on the global acetylation of histone H4 at lysine 16 and is not affected by depletion of common transcription elongation chromatin marks.
  Mol Cell Biol, 27, 7865-7870.  
17766249 S.Fujii, H.Kono, S.Takenaka, N.Go, and A.Sarai (2007).
Sequence-dependent DNA deformability studied using molecular dynamics simulations.
  Nucleic Acids Res, 35, 6063-6074.  
17169988 S.Nakano, T.Kirihata, S.Fujii, H.Sakai, M.Kuwahara, H.Sawai, and N.Sugimoto (2007).
Influence of cationic molecules on the hairpin to duplex equilibria of self-complementary DNA and RNA oligonucleotides.
  Nucleic Acids Res, 35, 486-494.  
17142268 S.Sharma, F.Ding, and N.V.Dokholyan (2007).
Multiscale modeling of nucleosome dynamics.
  Biophys J, 92, 1457-1470.  
17908792 W.Dang, and B.Bartholomew (2007).
Domain architecture of the catalytic subunit in the ISW2-nucleosome complex.
  Mol Cell Biol, 27, 8306-8317.  
17609864 W.J.Koopmans, A.Brehm, C.Logie, T.Schmidt, and J.van Noort (2007).
Single-pair FRET microscopy reveals mononucleosome dynamics.
  J Fluoresc, 17, 785-795.  
17935431 Z.Deng, I.Bald, E.Illenberger, and M.A.Huels (2007).
Hyperthermal (1-100 eV) nitrogen ion scattering damage to D-ribose and 2-deoxy-D-ribose films.
  J Chem Phys, 127, 144715.  
16469929 A.J.Barbera, J.V.Chodaparambil, B.Kelley-Clarke, V.Joukov, J.C.Walter, K.Luger, and K.M.Kaye (2006).
The nucleosomal surface as a docking station for Kaposi's sarcoma herpesvirus LANA.
  Science, 311, 856-861.
PDB code: 1zla
16167325 A.Perico, G.La Penna, and L.Arcesi (2006).
Electrostatic interactions with histone tails may bend linker DNA in chromatin.
  Biopolymers, 81, 20-28.  
16732285 A.Shundrovsky, C.L.Smith, J.T.Lis, C.L.Peterson, and M.D.Wang (2006).
Probing SWI/SNF remodeling of the nucleosome by unzipping single DNA molecules.
  Nat Struct Mol Biol, 13, 549-554.  
16595797 C.C.Bjorklund, and W.B.Davis (2006).
Attenuation of DNA charge transport by compaction into a nucleosome core particle.
  Nucleic Acids Res, 34, 1836-1846.  
17081973 C.M.English, M.W.Adkins, J.J.Carson, M.E.Churchill, and J.K.Tyler (2006).
Structural basis for the histone chaperone activity of Asf1.
  Cell, 127, 495-508.
PDB code: 2hue
16606615 C.Stockdale, A.Flaus, H.Ferreira, and T.Owen-Hughes (2006).
Analysis of nucleosome repositioning by yeast ISWI and Chd1 chromatin remodeling complexes.
  J Biol Chem, 281, 16279-16288.  
16714444 E.L.Mersfelder, and M.R.Parthun (2006).
The tale beyond the tail: histone core domain modifications and the regulation of chromatin structure.
  Nucleic Acids Res, 34, 2653-2662.  
16711856 F.Aumann, F.Lankas, M.Caudron, and J.Langowski (2006).
Monte Carlo simulation of chromatin stretching.
  Phys Rev E Stat Nonlin Soft Matter Phys, 73, 041927.  
16973479 F.Livolant, S.Mangenot, A.Leforestier, A.Bertin, M.Frutos, E.Raspaud, and D.Durand (2006).
Are liquid crystalline properties of nucleosomes involved in chromosome structure and dynamics?
  Philos Transact A Math Phys Eng Sci, 364, 2615-2633.  
16603492 G.Arya, Q.Zhang, and T.Schlick (2006).
Flexible histone tails in a new mesoscopic oligonucleosome model.
  Biophys J, 91, 133-150.  
16691563 G.La Penna, S.Furlan, and A.Perico (2006).
Modeling H3 histone N-terminal tail and linker DNA interactions.
  Biopolymers, 83, 135-147.  
16487697 H.Wurtele, and A.Verreault (2006).
Histone post-translational modifications and the response to DNA double-strand breaks.
  Curr Opin Cell Biol, 18, 137-144.  
16415862 J.D.Trzupek, J.M.Gottesfeld, and D.L.Boger (2006).
Alkylation of duplex DNA in nucleosome core particles by duocarmycin SA and yatakemycin.
  Nat Chem Biol, 2, 79-82.  
17099699 J.G.Yang, T.S.Madrid, E.Sevastopoulos, and G.J.Narlikar (2006).
The chromatin-remodeling enzyme ACF is an ATP-dependent DNA length sensor that regulates nucleosome spacing.
  Nat Struct Mol Biol, 13, 1078-1083.  
16891359 J.Z.Ruscio, and A.Onufriev (2006).
A computational study of nucleosomal DNA flexibility.
  Biophys J, 91, 4121-4132.  
16506092 K.Luger (2006).
Dynamic nucleosomes.
  Chromosome Res, 14, 5.  
16717183 L.Fan, and V.A.Roberts (2006).
Complex of linker histone H5 with the nucleosome and its implications for chromatin packing.
  Proc Natl Acad Sci U S A, 103, 8384-8389.  
17184543 L.Mariño-Ramírez, I.K.Jordan, and D.Landsman (2006).
Multiple independent evolutionary solutions to core histone gene regulation.
  Genome Biol, 7, R122.  
16648479 M.A.Parra, D.Kerr, D.Fahy, D.J.Pouchnik, and J.J.Wyrick (2006).
Deciphering the roles of the histone H2B N-terminal domain in genome-wide transcription.
  Mol Cell Biol, 26, 3842-3852.  
17092350 M.Ducasse, and M.A.Brown (2006).
Epigenetic aberrations and cancer.
  Mol Cancer, 5, 60.  
16808625 M.Roginskaya, W.A.Bernhard, and Y.Razskazovskiy (2006).
Protection of DNA against direct radiation damage by complex formation with positively charged polypeptides.
  Radiat Res, 166, 9.  
16885027 M.Yang, C.B.Gocke, X.Luo, D.Borek, D.R.Tomchick, M.Machius, Z.Otwinowski, and H.Yu (2006).
Structural basis for CoREST-dependent demethylation of nucleosomes by the human LSD1 histone demethylase.
  Mol Cell, 23, 377-387.
PDB code: 2iw5
16565063 N.Korolev, A.P.Lyubartsev, and L.Nordenskiöld (2006).
Computer modeling demonstrates that electrostatic attraction of nucleosomal DNA is mediated by histone tails.
  Biophys J, 90, 4305-4316.  
16533846 N.Sluis-Cremer, and E.S.Kempner (2006).
Radiation target analyses of DNA template/primer complexes.
  Biophys J, 90, L61-L63.  
17078040 O.Li, D.Vasudevan, C.A.Davey, and P.Dröge (2006).
High-level expression of DNA architectural factor HMGA2 and its association with nucleosomes in human embryonic stem cells.
  Genesis, 44, 523-529.  
16714106 P.J.Robinson, and D.Rhodes (2006).
Structure of the '30 nm' chromatin fibre: a key role for the linker histone.
  Curr Opin Struct Biol, 16, 336-343.  
16845070 P.Luykx, I.V.Bajić, and S.Khuri (2006).
NXSensor web tool for evaluating DNA for nucleosome exclusion sequences and accessibility to binding factors.
  Nucleic Acids Res, 34, W560-W565.  
16716593 R.J.Ellis (2006).
Molecular chaperones: assisting assembly in addition to folding.
  Trends Biochem Sci, 31, 395-401.  
16506095 S.J.McBryant, V.H.Adams, and J.C.Hansen (2006).
Chromatin architectural proteins.
  Chromosome Res, 14, 39-51.  
17038564 S.M.Johnson, F.J.Tan, H.L.McCullough, D.P.Riordan, and A.Z.Fire (2006).
Flexibility and constraint in the nucleosome core landscape of Caenorhabditis elegans chromatin.
  Genome Res, 16, 1505-1516.  
16903784 W.J.Lane, and S.A.Darst (2006).
The structural basis for promoter -35 element recognition by the group IV sigma factors.
  PLoS Biol, 4, e269.
PDB code: 2h27
16475805 W.S.Kontur, R.M.Saecker, C.A.Davis, M.W.Capp, and M.T.Record (2006).
Solute probes of conformational changes in open complex (RPo) formation by Escherichia coli RNA polymerase at the lambdaPR promoter: evidence for unmasking of the active site in the isomerization step and for large-scale coupled folding in the subsequent conversion to RPo.
  Biochemistry, 45, 2161-2177.  
16936830 X.Wang, and J.J.Hayes (2006).
Physical methods used to study core histone tail structures and interactions in solution.
  Biochem Cell Biol, 84, 578-588.  
16689642 Y.Levy, and J.N.Onuchic (2006).
Water mediation in protein folding and molecular recognition.
  Annu Rev Biophys Biomol Struct, 35, 389-415.  
16880972 A.Imhof, and T.Bonaldi (2005).
"Chromatomics" the analysis of the chromatome.
  Mol Biosyst, 1, 112-116.  
16116097 A.J.Danford, D.Wang, Q.Wang, T.D.Tullius, and S.J.Lippard (2005).
Platinum anticancer drug damage enforces a particular rotational setting of DNA in nucleosomes.
  Proc Natl Acad Sci U S A, 102, 12311-12316.  
15624215 A.Ramaswamy, I.Bahar, and I.Ioshikhes (2005).
Structural dynamics of nucleosome core particle: comparison with nucleosomes containing histone variants.
  Proteins, 58, 683-696.  
16242031 B.D.Silverman (2005).
Asymmetry in the burial of hydrophobic residues along the histone chains of eukarya, archaea and a transcription factor.
  BMC Struct Biol, 5, 20.  
15871046 B.D.Silverman (2005).
The hydrophobicity of the H3 histone fold differs from the hydrophobicity of the other three folds.
  J Mol Evol, 60, 354-364.  
15933069 B.Xiao, C.Jing, G.Kelly, P.A.Walker, F.W.Muskett, T.A.Frenkiel, S.R.Martin, K.Sarma, D.Reinberg, S.J.Gamblin, and J.R.Wilson (2005).
Specificity and mechanism of the histone methyltransferase Pr-Set7.
  Genes Dev, 19, 1444-1454.
PDB code: 2bqz
  16511091 C.M.Wood, J.M.Nicholson, S.J.Lambert, L.Chantalat, C.D.Reynolds, and J.P.Baldwin (2005).
High-resolution structure of the native histone octamer.
  Acta Crystallogr Sect F Struct Biol Cryst Commun, 61, 541-545.
PDB code: 1tzy
16094444 C.N.Johnson, N.L.Adkins, and P.Georgel (2005).
Chromatin remodeling complexes: ATP-dependent machines in action.
  Biochem Cell Biol, 83, 405-417.  
16260619 E.M.Hyland, M.S.Cosgrove, H.Molina, D.Wang, A.Pandey, R.J.Cottee, and J.D.Boeke (2005).
Insights into the role of histone H3 and histone H4 core modifiable residues in Saccharomyces cerevisiae.
  Mol Cell Biol, 25, 10060-10070.  
16015338 H.Masumoto, D.Hawke, R.Kobayashi, and A.Verreault (2005).
A role for cell-cycle-regulated histone H3 lysine 56 acetylation in the DNA damage response.
  Nature, 436, 294-298.  
16339114 J.P.Wang, and J.Widom (2005).
Improved alignment of nucleosome DNA sequences using a mixture model.
  Nucleic Acids Res, 33, 6743-6755.  
15919827 J.Sun, Q.Zhang, and T.Schlick (2005).
Electrostatic mechanism of nucleosomal array folding revealed by computer simulation.
  Proc Natl Acad Sci U S A, 102, 8180-8185.  
15657106 K.Coeytaux, and A.Poupon (2005).
Prediction of unfolded segments in a protein sequence based on amino acid composition.
  Bioinformatics, 21, 1891-1900.  
15687486 K.F.Tóth, J.Mazurkiewicz, and K.Rippe (2005).
Association states of nucleosome assembly protein 1 and its complexes with histones.
  J Biol Chem, 280, 15690-15699.  
16209651 L.Mariño-Ramírez, M.G.Kann, B.A.Shoemaker, and D.Landsman (2005).
Histone structure and nucleosome stability.
  Expert Rev Proteomics, 2, 719-729.  
16094450 M.S.Cosgrove, and C.Wolberger (2005).
How does the histone code work?
  Biochem Cell Biol, 83, 468-476.  
15728351 M.Tomschik, H.Zheng, K.van Holde, J.Zlatanova, and S.H.Leuba (2005).
Fast, long-range, reversible conformational fluctuations in nucleosomes revealed by single-pair fluorescence resonance energy transfer.
  Proc Natl Acad Sci U S A, 102, 3278-3283.  
16142222 P.B.Becker (2005).
Nucleosome remodelers on track.
  Nat Struct Mol Biol, 12, 732-733.  
15723344 P.S.Espino, B.Drobic, K.L.Dunn, and J.R.Davie (2005).
Histone modifications as a platform for cancer therapy.
  J Cell Biochem, 94, 1088-1102.  
16025127 R.Strohner, M.Wachsmuth, K.Dachauer, J.Mazurkiewicz, J.Hochstatter, K.Rippe, and G.Längst (2005).
A 'loop recapture' mechanism for ACF-dependent nucleosome remodeling.
  Nat Struct Mol Biol, 12, 683-690.  
16212490 S.Henikoff, and K.Ahmad (2005).
Assembly of variant histones into chromatin.
  Annu Rev Cell Dev Biol, 21, 133-153.  
16001076 T.Schalch, S.Duda, D.F.Sargent, and T.J.Richmond (2005).
X-ray structure of a tetranucleosome and its implications for the chromatin fibre.
  Nature, 436, 138-141.
PDB code: 1zbb
16183641 Y.Tanaka, H.Tachiwana, K.Yoda, H.Masumoto, T.Okazaki, H.Kurumizaka, and S.Yokoyama (2005).
Human centromere protein B induces translational positioning of nucleosomes on alpha-satellite sequences.
  J Biol Chem, 280, 41609-41618.  
15951514 Y.Tsunaka, N.Kajimura, S.Tate, and K.Morikawa (2005).
Alteration of the nucleosomal DNA path in the crystal structure of a human nucleosome core particle.
  Nucleic Acids Res, 33, 3424-3434.
PDB code: 2cv5
15789029 A.Lusser, and J.T.Kadonaga (2004).
Strategies for the reconstitution of chromatin.
  Nat Methods, 1, 19-26.  
15284898 A.M.Erkine (2004).
Activation domains of gene-specific transcription factors: are histones among their targets?
  Biochem Cell Biol, 82, 453-459.  
15567867 B.Dorigo, T.Schalch, A.Kulangara, S.Duda, R.R.Schroeder, and T.J.Richmond (2004).
Nucleosome arrays reveal the two-start organization of the chromatin fiber.
  Science, 306, 1571-1573.  
15139817 B.Jayaram, and T.Jain (2004).
The role of water in protein-DNA recognition.
  Annu Rev Biophys Biomol Struct, 33, 343-361.  
14993711 D.F.Sargent, and T.J.Richmond (2004).
Comment on Flash-cooling of macromolecular crystals to overcome increased mosaicity by Yao, Yasutake & Tanaka (2004).
  Acta Crystallogr D Biol Crystallogr, 60, 616.  
15377519 D.N.Nikova, L.H.Pope, M.L.Bennink, K.A.van Leijenhorst-Groener, K.van der Werf, and J.Greve (2004).
Unexpected binding motifs for subnucleosomal particles revealed by atomic force microscopy.
  Biophys J, 87, 4135-4145.  
15347582 F.J.Solis, R.Bash, J.Yodh, S.M.Lindsay, and D.Lohr (2004).
A statistical thermodynamic model applied to experimental AFM population and location data is able to quantify DNA-histone binding strength and internucleosomal interaction differences between acetylated and unacetylated nucleosomal arrays.
  Biophys J, 87, 3372-3387.  
15659848 J.M.Nicholson, C.M.Wood, C.D.Reynolds, A.Brown, S.J.Lambert, L.Chantalat, and J.P.Baldwin (2004).
Histone structures: targets for modifications by molecular assemblies.
  Ann N Y Acad Sci, 1030, 644-655.  
15131696 M.N.Kagalwala, B.J.Glaus, W.Dang, M.Zofall, and B.Bartholomew (2004).
Topography of the ISW2-nucleosome complex: insights into nucleosome spacing and chromatin remodeling.
  EMBO J, 23, 2092-2104.  
14578347 M.Okuwaki, and A.Verreault (2004).
Maintenance DNA methylation of nucleosome core particles.
  J Biol Chem, 279, 2904-2912.  
15523479 M.S.Cosgrove, J.D.Boeke, and C.Wolberger (2004).
Regulated nucleosome mobility and the histone code.
  Nat Struct Mol Biol, 11, 1037-1043.  
15100411 R.S.Edayathumangalam, P.Weyermann, J.M.Gottesfeld, P.B.Dervan, and K.Luger (2004).
Molecular recognition of the nucleosomal "supergroove".
  Proc Natl Acad Sci U S A, 101, 6864-6869.
PDB code: 1s32
15262970 R.Schwanbeck, H.Xiao, and C.Wu (2004).
Spatial contacts and nucleosome step movements induced by the NURF chromatin remodeling complex.
  J Biol Chem, 279, 39933-39941.  
14739929 U.M.Muthurajan, Y.Bao, L.J.Forsberg, R.S.Edayathumangalam, P.N.Dyer, C.L.White, and K.Luger (2004).
Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions.
  EMBO J, 23, 260-271.
PDB codes: 1p34 1p3a 1p3b 1p3f 1p3g 1p3i 1p3k 1p3l 1p3m 1p3o 1p3p
15020582 Y.J.Park, P.N.Dyer, D.J.Tremethick, and K.Luger (2004).
A new fluorescence resonance energy transfer approach demonstrates that the histone variant H2AZ stabilizes the histone octamer within the nucleosome.
  J Biol Chem, 279, 24274-24282.  
14560021 A.Flaus, and T.Owen-Hughes (2003).
Dynamic properties of nucleosomes during thermal and ATP-driven mobilization.
  Mol Cell Biol, 23, 7767-7779.  
12581654 C.W.Akey, and K.Luger (2003).
Histone chaperones and nucleosome assembly.
  Curr Opin Struct Biol, 13, 6.  
12697747 C.Zheng, and J.J.Hayes (2003).
Intra- and inter-nucleosomal protein-DNA interactions of the core histone tail domains in a model system.
  J Biol Chem, 278, 24217-24224.  
12855162 H.Higashibata, M.A.Siddiqui, M.Takagi, T.Imanaka, and S.Fujiwara (2003).
Surface histidine residue of archaeal histone affects DNA compaction and thermostability.
  FEMS Microbiol Lett, 224, 17-22.  
14656442 H.Sondermann, S.M.Soisson, D.Bar-Sagi, and J.Kuriyan (2003).
Tandem histone folds in the structure of the N-terminal segment of the ras activator Son of Sevenless.
  Structure, 11, 1583-1593.
PDB code: 1q9c
12626519 I.Berger, C.Bieniossek, C.Schaffitzel, M.Hassler, E.Santelli, and T.J.Richmond (2003).
Direct interaction of Ca2+/calmodulin inhibits histone deacetylase 5 repressor core binding to myocyte enhancer factor 2.
  J Biol Chem, 278, 17625-17635.  
12612068 I.Whitehouse, C.Stockdale, A.Flaus, M.D.Szczelkun, and T.Owen-Hughes (2003).
Evidence for DNA translocation by the ISWI chromatin-remodeling enzyme.
  Mol Cell Biol, 23, 1935-1945.  
14645090 J.F.Kepert, K.F.Tóth, M.Caudron, N.Mücke, J.Langowski, and K.Rippe (2003).
Conformation of reconstituted mononucleosomes and effect of linker histone H1 binding studied by scanning force microscopy.
  Biophys J, 85, 4012-4022.  
12897842 J.R.Daban (2003).
High concentration of DNA in condensed chromatin.
  Biochem Cell Biol, 81, 91-99.  
12672489 K.Luger (2003).
Structure and dynamic behavior of nucleosomes.
  Curr Opin Genet Dev, 13, 127-135.  
12876341 L.Chantalat, J.M.Nicholson, S.J.Lambert, A.J.Reid, M.J.Donovan, C.D.Reynolds, C.M.Wood, and J.P.Baldwin (2003).
Structure of the histone-core octamer in KCl/phosphate crystals at 2.15 A resolution.
  Acta Crystallogr D Biol Crystallogr, 59, 1395-1407.
PDB code: 1hq3
12879489 M.García-Pérez, M.Pinto, and J.A.Subirana (2003).
Nonsequence-specific arginine interactions in the nucleosome core particle.
  Biopolymers, 69, 432-439.  
12928440 S.J.McBryant, Y.J.Park, S.M.Abernathy, P.J.Laybourn, J.K.Nyborg, and K.Luger (2003).
Preferential binding of the histone (H3-H4)2 tetramer by NAP1 is mediated by the amino-terminal histone tails.
  J Biol Chem, 278, 44574-44583.  
12668465 S.Mangenot, A.Leforestier, D.Durand, and F.Livolant (2003).
X-ray diffraction characterization of the dense phases formed by nucleosome core particles.
  Biophys J, 84, 2570-2584.  
14536084 T.Grüne, J.Brzeski, A.Eberharter, C.R.Clapier, D.F.Corona, P.B.Becker, and C.W.Müller (2003).
Crystal structure and functional analysis of a nucleosome recognition module of the remodeling factor ISWI.
  Mol Cell, 12, 449-460.
PDB code: 1ofc
12736678 T.J.Richmond, and C.A.Davey (2003).
The structure of DNA in the nucleosome core.
  Nature, 423, 145-150.  
12169666 C.A.Davey, and T.J.Richmond (2002).
DNA-dependent divalent cation binding in the nucleosome core particle.
  Proc Natl Acad Sci U S A, 99, 11169-11174.  
The most recent references are shown first. Citation data come partly from CiteXplore and partly from an automated harvesting procedure. Note that this is likely to be only a partial list as not all journals are covered by either method. However, we are continually building up the citation data so more and more references will be included with time. Where a reference describes a PDB structure, the PDB code is shown on the right.

 

spacer
spacer