PDBsum entry 2vix

Transport protein

PDB id: 2vix

Contents

Protein chains

283 a.a. *

Ligands

ACT

GOL ×2

Waters ×134

* Residue conservation analysis

PDB id:

2vix

Name:

Transport protein

Title:

Methylated shigella flexneri mxic

Structure:

Protein mxic. Chain: a, b, c. Fragment: residues 74-355. Synonym: mxic. Engineered: yes. Other_details: the construct is a deletion of the first 73 residues and was methylated chemically following walter et al, structure 14, 1617-1622 (2006)

Source:

Shigella flexneri. Organism_taxid: 623. Strain: pwr100. Expressed in: escherichia coli. Expression_system_taxid: 469008.

Resolution:

2.85Å R-factor: 0.244 R-free: 0.273

Authors:

J.E.Deane,P.Roversi,C.King,S.Johnson,S.M.Lea

Key ref:

J.E.Deane et al. (2008). Structures of the Shigella flexneri type 3 secretion system protein MxiC reveal conformational variability amongst homologues. J Mol Biol, 377, 985-992. PubMed id: 18304577 DOI: 10.1016/j.jmb.2008.01.072

Date:

05-Dec-07 Release date: 11-Mar-08

Protein chains

Q04640  (MXIC_SHIFL) -  Protein MxiC from Shigella flexneri

Seq: 355 a.a.

Struc: 283 a.a.*

* PDB and UniProt seqs differ at 21 residue positions (black crosses)

DOI no: 10.1016/j.jmb.2008.01.072

J Mol Biol 377:985-992 (2008)

PubMed id: 18304577

Structures of the Shigella flexneri type 3 secretion system protein MxiC reveal conformational variability amongst homologues.

J.E.Deane, P.Roversi, C.King, S.Johnson, S.M.Lea.

ABSTRACT

Many Gram-negative pathogenic bacteria use a complex macromolecular machine, known as the type 3 secretion system (T3SS), to transfer virulence proteins into host cells. The T3SS is composed of a cytoplasmic bulb, a basal body spanning the inner and outer bacterial membranes, and an extracellular needle. Secretion is regulated by both cytoplasmic and inner membrane proteins that must respond to specific signals in order to ensure that virulence proteins are not secreted before contact with a eukaryotic cell. This negative regulation is mediated, in part, by a family of proteins that are thought to physically block the entrance to the secretion apparatus until an appropriate signal is received following host cell contact. Despite weak sequence homology between proteins of this family, the crystal structures of Shigella flexneri MxiC we present here confirm the conservation of domain topology with the homologue from Yersinia sp. Interestingly, comparison of the Shigella and Yersinia structures reveals a significant structural change that results in substantial domain re-arrangement and opening of one face of the molecule. The conservation of a negatively charged patch on this face suggests it may have a role in binding other components of the T3SS.

Selected figure(s)

Figure 1.
Fig. 1. Size-exclusion chromatography and limited proteolysis of MxiC. a, Elution of MxiC[FL] (continuous line) and MxiC[NΔ73] (broken line) from a HiLoad 16/60 Superdex 200 column pre-equilibrated in 20 mM Tris (pH 7.5), 150 mM NaCl. MxiC[FL] and MxiC[NΔ73] elute as monomers as single, slightly asymmetric peaks. b, SDS-PAGE of limited proteolysis of MxiC[FL]. Degradation of purified MxiC[FL] was considerable after storage at 4 °C for eight weeks (lane 1). Limited proteolysis was carried out on freshly purified MxiC[FL] incubated for 2 h at 20 °C with an increasing mass ratio of protein:subtilisin from 20 μg:2 ng to 20 μg:80 ng (lanes 2–6). Methods: DNA fragments of the mxiC gene encoding residues 1–355 (full length, MxiC[FL]) and 74–355 (N-terminal truncation, MxiC[NΔ73]) were produced by PCR (FLf, CATATGCTTGATGTTAAAAATACAGGAGTTTTT; N73f, CATATGAGTCAGGAACGTATTTTAGAT; FLr, GAATTCTTATCTAGAAAGCTCTTTCTTGTATGCACT) and cloned into the NdeI-EcoRI sites of the pET28b vector. These constructs include an N-terminal His[6]-tag and a thrombin cleavage site. MxiC constructs were expressed in Escherichia coli BL21 (DE3) cells grown in LB medium containing 34 μg ml^− 1 kanamycin. Cells were grown at 37 °C until an A[600] nm of vert, similar 0.6 was reached, whereupon they were cooled to 20 °C and protein over-expression was induced by the addition of IPTG (1.0 mM final concentration). After vert, similar 16 h, cells were harvested by centrifugation (15 min, 5000g, 4 °C) and pellets were frozen at – 80 °C. Cell pellets were resuspended in lysis buffer (20 mM Tris (pH 7.5), 500 mM NaCl and Complete EDTA-free Protease Inhibitor Cocktail, Roche) and lysed using an Emulsiflex-C5 Homogeniser (Glen Creston, UK). The resultant cell suspension was centrifuged (20 min, 20,000g, 4 °C) and the soluble fraction was applied to a pre-charged HisTrap FF nickel affinity column (GE Life Sciences). Protein was eluted using a gradient of 0–1 M imidazole in 20 mM Tris (pH 7.5), 500 mM NaCl and fractions containing MxiC were further purified by size-exclusion chromatography as described above. SDS-PAGE analysis revealed MxiC[FL] and MxiC[NΔ73] to be pure (data not shown). Fractions containing purified MxiC were pooled and concentrated using Millipore Ultra-15 10 k MWCO centrifugal filtration devices to 7 mg ml^− 1 and stored at 4 °C. Selenomethionine (SeMet)-labeled MxiC was produced by expression in the E.coli met^− auxotrophic strain B834 (DE3). Cultures were grown in LB medium to an A[600 nm] of 0.9 then pelleted (15 min, 4000g, 4 °C) and washed in PBS three times before being used to inoculate SelenoMet Medium Base™ containing SelenoMet Nutrient Mix™ (Molecular Dimensions). Cells were grown and induced as described above. SeMet-labeled protein was purified as described above. Full incorporation of selenomethionine was confirmed by mass spectrometry. Dynamic light-scattering experiments were performed on a Viscotek model 802 DLS instrument using the OmniSIZE 2.0 acquisition and control software according to the manufacturer's instructions at 20 °C on a 1 mg ml^− 1 protein sample in 20 mM Tris (pH 7.5), 150 mM NaCl.

Figure 2.
Fig. 2. The structure and topology of MxiC. a, A ribbon diagram of MxiC, colored from blue at the N terminus to red at the C terminus. Views rotated by 90° about the long axis are shown. b, A diagram of the topology of MxiC illustrating the four-helix X-bundle of each domain colored as for a. c, Two molecules of MxiC from the P2[1]2[1]2[1] crystal form (molecule B in magenta and molecule C in cyan), overlaid via their central domain (residues 154–265), illustrating the extremes of the movement seen for domains 1 and 3 (shown with cylindrical helices). Methods: Initial crystallization conditions were obtained by sparse-matrix screening,^30 using the sitting drop vapor diffusion technique. Drops were prepared using an OryxNano crystallization robot (Douglas Instruments) by mixing 0.2 μl of protein (7 mg ml^− 1 in 20 mM Tris (pH 7.5), 150 mM NaCl) with 0.2 μl of reservoir solution and were equilibrated against 100 μl of reservoir solution at 20 °C. Initial, low-resolution diffracting crystals of MxiC[FL] grew within two weeks in condition P2-26 of the PACT Premier screen (0.2 M NaBr, 0.1 M BisTris–propane (pH 7.5), 20% (w/v) PEG3350: space group P4[3]2[1]2 with one molecule in the asymmetric unit) and condition 3 of Molecular Dimensions Structure Screen II (2% (v/v) dioxane, 0.1 M bicine (pH 9.0), 10% (w/v) PEG20000: two different, related P2[1] forms with two molecules in the asymmetric unit). The former condition yielded diffraction-quality crystals of SeMet-labeled MxiC[FL]†. Crystals of native MxiC[FL] diffracting to 3.0 Å resolution grew in 0.2 M Na[2]SO[4], 0.1 M BisTris–propane (pH 6.5), 20% (w/v) PEG3350, again in P4[3]2[1]2 but with a longer c axis and two molecules in the asymmetric unit. The methylation reaction was performed as described in Refs. 31 and 32 on purified MxiC[FL] and MxiC[NΔ73] each at 1 mg ml^− 1 in 50 mM Hepes (pH 7.5), 250 mM NaCl. Samples were centrifuged (5 min, 13,000 rpm, 10,000g 4 °C) before purification of soluble methylated protein by size-exclusion chromatography (as described above). Methylation of all lysine side chains and the N terminus was verified by mass spectrometry (42,952 Da for MxiC[FL] and 35,106 Da for MxiC[NΔ73]). The P222 crystal form grew in 1.0 M succinic acid, 0.1 M Hepes (pH 7.0), 1% (w/v) PEG2000MME. The P2[1]2[1]2[1] crystal form grew in 0.2 M sodium acetate, 0.1 M BisTris–propane (pH 7.5), 20% (w/v) PEG3350. Crystals of MxiC were cryoprotected in reservoir solution containing 25% (v/v) glycerol for 15 s and flash cryocooled in liquid nitrogen for data collection. Diffraction data were recorded at 100 K. Data were indexed and integrated in MOSFLM,^33 and scaled with Scala,^34 within the CCP4 program suite,^35 except for the native MxiC[FL] P4[3]2[1]2 3.0 Å dataset, which was indexed in Labelit^36 and integrated in XDS,^37 both run from the processing suite Xia2 (G. Winter et al., unpublished program). Initial phases were computed using SHARP:^38 five sites were found by SHELXD^39 run from the suite of programs autoSHARP^40 against F[A]s calculated from the peak, inflexion and low-energy remote wavelengths of a SeMet-labeled P4[3]2[1]2 MxiC[FL] crystal. The coordinates and B-factors of these sites were refined in SHARP against the above data plus the second remote wavelength from the same SeMet crystal. Solvent flattening was performed using CCP4-DM^41 and SOLOMON,^42 yielding a 3.5 Å map that was used for initial model building guided by the YopN–TyeA structure (PDB ID 1xl3).^5 After alternate cycles of model building in Coot,^43 refinement in Buster-TNT,^44 and simulated annealing in PHENIX,^45 this initial model was used for molecular replacement, using CCP4 PHASER,^46 into the higher resolution P2[1]2[1]2[1] form. The resultant model was used for molecular replacement against the MxiC[NΔ73] P222 and native MxiC[FL] P4[3]2[1]2 crystal forms. The final Buster-TNT refinements in the latter forms used NCS restraints throughout, and extra geometry restraints tying the geometry to Refmac^47-refined models, to improve the stereochemistry (as Refmac5 implements torsion angle restraints and can refine riding H atoms), a refinement strategy devised by Dr. Stephen Graham (University of Oxford).

The above figures are reprinted by permission from Elsevier: J Mol Biol (2008, 377, 985-992) copyright 2008.

Figures were selected by an automated process.