RNA chain A

23S ribosomal RNA

Source organism: Haloarcula marismortui [2238]
As chain: A
Length: 602 nucleotides
Theoretical weight: 194.85 KDa
FASTA Sequence
>pdb|1ffz|A
UUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGACGUGGUCGCCGAUGUGCAGCAUAGGUAGGAGACACUACACAGGUACCCGCGCUAGCGGGCCACCGAGUCAACAGUGAAAUACUACCCGUCGGUGACUGCGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGACAGAGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUUGUUCGCCUAUUAAAGGAGGUCGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUA

Visualisation