HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept
{
"links": {
"first": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607/samples?format=api&page=1",
"last": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607/samples?format=api&page=30",
"next": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607/samples?format=api&page=2",
"prev": null
},
"data": [
{
"type": "samples",
"id": "ERS756267",
"attributes": {
"latitude": 55.0295,
"longitude": 8.4344,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "14",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-08-15",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: TTCCGGTT; r: AACCGCAT",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Schleswig Holstein, Sylt, List, Odewatt",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461369",
"accession": "ERS756267",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Sylt, 2012-08-15; sample taken after field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01; oyster from Texel, translocated from Texel (NL) to Sylt (D)",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Sylt, translocated from Texel (NL)",
"sample-alias": "Cg_72_Hem_Sy_TxA_20120815",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756267/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756267/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756267?format=api"
}
},
{
"type": "samples",
"id": "ERS756268",
"attributes": {
"latitude": 55.0296,
"longitude": 8.4343,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "17.112",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-07-19",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: GCTTGCAA; r: AACCGCAT",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Schleswig Holstein, Sylt, List, Odewatt",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461370",
"accession": "ERS756268",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Sylt, 2012-07-19; sample taken after field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01; oyster from Sylt, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Sylt",
"sample-alias": "Cg_79_Hem_Sy_SyA_20120719",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756268/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756268/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756268?format=api"
}
},
{
"type": "samples",
"id": "ERS756269",
"attributes": {
"latitude": 55.0292,
"longitude": 8.4343,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "14",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-06-01",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: GCTTGCAA; r: AACCGCAT",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "None",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "not antibiotic treated",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Schleswig Holstein, Sylt, List, Odewatt",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461371",
"accession": "ERS756269",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Sylt, 2012-06-01; sample taken in the lab, after the treatment and before field deployment; not antibiotic treated; oyster from Sylt, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Sylt",
"sample-alias": "Cg_165_Hem_Sy_SyC_20120601",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756269/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756269/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756269?format=api"
}
},
{
"type": "samples",
"id": "ERS756270",
"attributes": {
"latitude": 53.1569,
"longitude": 4.905,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "19.67009995",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-07-27",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: CATGAGGA; r: TCTCGTCA",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461372",
"accession": "ERS756270",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-07-27; sample taken after field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14; oyster from Sylt, translocated from Sylt (D) to Texel (NL)",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel, translocated from Sylt",
"sample-alias": "Cg_95_Hem_Tx_SyA_20120727",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756270/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756270/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756270?format=api"
}
},
{
"type": "samples",
"id": "ERS756271",
"attributes": {
"latitude": 53.1567,
"longitude": 4.9046,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "15.12717638",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-06-14",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: CAGTTGAC; r: TCTCGTCA",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461373",
"accession": "ERS756271",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14; oyster from Texel, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel",
"sample-alias": "Cg_54_Hem_Tx_TxA_20120614",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756271/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756271/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756271?format=api"
}
},
{
"type": "samples",
"id": "ERS756272",
"attributes": {
"latitude": 53.1567,
"longitude": 4.9046,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "15.12717638",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-06-14",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: CATGAGGA; r: TCTCGTCA",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461374",
"accession": "ERS756272",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14; oyster from Texel, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel",
"sample-alias": "Cg_8_Hem_Tx_TxA_20120614",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756272/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756272/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756272?format=api"
}
},
{
"type": "samples",
"id": "ERS756273",
"attributes": {
"latitude": 53.1569,
"longitude": 4.9046,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "19.67009995",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-07-27",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: CTAGTCGA; r: TCTCGTCA",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "None",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "not antibiotic treated",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461375",
"accession": "ERS756273",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-07-27; sample taken after field deployment; not antibiotic treated; oyster from Texel, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel",
"sample-alias": "Cg_72_Hem_Tx_TxC_20120727",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756273/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756273/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756273?format=api"
}
},
{
"type": "samples",
"id": "ERS756274",
"attributes": {
"latitude": 53.1567,
"longitude": 4.9046,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "15.12717638",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-06-14",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: CTAGTCGA; r: TCTCGTCA",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461376",
"accession": "ERS756274",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14; oyster from Sylt, translocated from Sylt (D) to Texel (NL)",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel, translocated from Sylt",
"sample-alias": "Cg_27_Hem_Tx_SyA_20120614",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756274/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756274/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756274?format=api"
}
},
{
"type": "samples",
"id": "ERS756275",
"attributes": {
"latitude": 53.1564,
"longitude": 4.9046,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "19.67009995",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-07-27",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: GCTTGCAA; r: TCTCGTCA",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "None",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "not antibiotic treated",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461377",
"accession": "ERS756275",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-07-27; sample taken after field deployment; not antibiotic treated; oyster from Texel, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel",
"sample-alias": "Cg_84_Hem_Tx_TxC_20120727",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756275/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756275/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756275?format=api"
}
},
{
"type": "samples",
"id": "ERS756276",
"attributes": {
"latitude": 53.1564,
"longitude": 4.9046,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "19.67009995",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-07-27",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: AGAGGTGT; r: TCTCGTCA",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "None",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "not antibiotic treated",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461378",
"accession": "ERS756276",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-07-27; sample taken after field deployment; not antibiotic treated; oyster from Sylt, translocated from Sylt (D) to Texel (NL)",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel, translocated from Sylt",
"sample-alias": "Cg_47_Hem_Tx_SyC_20120727",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756276/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756276/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756276?format=api"
}
},
{
"type": "samples",
"id": "ERS756277",
"attributes": {
"latitude": 53.1567,
"longitude": 4.9046,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "15.12717638",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-06-14",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: GCTTGCAA; r: TCTCGTCA",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461379",
"accession": "ERS756277",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14; oyster from Texel, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel",
"sample-alias": "Cg_104_Hem_Tx_TxA_20120614",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756277/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756277/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756277?format=api"
}
},
{
"type": "samples",
"id": "ERS756278",
"attributes": {
"latitude": 53.1567,
"longitude": 4.9046,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "15.12717638",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-06-14",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: AGAGGTGT; r: TCTCGTCA",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461380",
"accession": "ERS756278",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14; oyster from Texel, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel",
"sample-alias": "Cg_90_Hem_Tx_TxA_20120614",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756278/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756278/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756278?format=api"
}
},
{
"type": "samples",
"id": "ERS756279",
"attributes": {
"latitude": 53.1568,
"longitude": 4.9048,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "19.67009995",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-07-27",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: GCTACGAT; r: TCTCGTCA",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "None",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "not antibiotic treated",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461381",
"accession": "ERS756279",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-07-27; sample taken after field deployment; not antibiotic treated; oyster from Texel, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel",
"sample-alias": "Cg_74_Hem_Tx_TxC_20120727",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756279/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756279/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756279?format=api"
}
},
{
"type": "samples",
"id": "ERS756280",
"attributes": {
"latitude": 53.1567,
"longitude": 4.9046,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "15.12717638",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-06-14",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: GCTACGAT; r: TCTCGTCA",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461382",
"accession": "ERS756280",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14; oyster from Sylt, translocated from Sylt (D) to Texel (NL)",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel, translocated from Sylt",
"sample-alias": "Cg_79_Hem_Tx_SyA_20120614",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756280/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756280/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756280?format=api"
}
},
{
"type": "samples",
"id": "ERS756281",
"attributes": {
"latitude": 53.1568,
"longitude": 4.9048,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "20.45783428",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-08-24",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: TTCCGGTT; r: TTGGTACG",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "None",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "not antibiotic treated",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461383",
"accession": "ERS756281",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-08-24; sample taken after field deployment; not antibiotic treated; oyster from Texel, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel",
"sample-alias": "Cg_74_Hem_Tx_TxC_20120824",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756281/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756281/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756281?format=api"
}
},
{
"type": "samples",
"id": "ERS756282",
"attributes": {
"latitude": 53.1567,
"longitude": 4.9046,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "15.12717638",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-06-14",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: TTCCGGTT; r: TTGGTACG",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "None",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "not antibiotic treated",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461384",
"accession": "ERS756282",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; not antibiotic treated; oyster from Texel, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel",
"sample-alias": "Cg_28_Hem_Tx_TxC_20120614",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756282/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756282/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756282?format=api"
}
},
{
"type": "samples",
"id": "ERS756283",
"attributes": {
"latitude": 53.1569,
"longitude": 4.9046,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "20.45783428",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-08-24",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: GTCACTCT; r: TTGGTACG",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "None",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "not antibiotic treated",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461385",
"accession": "ERS756283",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-08-24; sample taken after field deployment; not antibiotic treated; oyster from Texel, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel",
"sample-alias": "Cg_18_Hem_Tx_TxC_20120824",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756283/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756283/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756283?format=api"
}
},
{
"type": "samples",
"id": "ERS756284",
"attributes": {
"latitude": 53.1569,
"longitude": 4.9046,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "20.45783428",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-08-24",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: ACCAGTTG; r: TTGGTACG",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "None",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "not antibiotic treated",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461386",
"accession": "ERS756284",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-08-24; sample taken after field deployment; not antibiotic treated; oyster from Sylt, translocated from Sylt (D) to Texel (NL)",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel, translocated from Sylt",
"sample-alias": "Cg_103_Hem_Tx_SyC_20120824",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756284/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756284/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756284?format=api"
}
},
{
"type": "samples",
"id": "ERS756285",
"attributes": {
"latitude": 53.1567,
"longitude": 4.9046,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "15.12717638",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-06-14",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: GTCACTCT; r: TTGGTACG",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "None",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "not antibiotic treated",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461387",
"accession": "ERS756285",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; not antibiotic treated; oyster from Texel, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel",
"sample-alias": "Cg_24_Hem_Tx_TxC_20120614",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756285/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756285/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756285?format=api"
}
},
{
"type": "samples",
"id": "ERS756286",
"attributes": {
"latitude": 53.1567,
"longitude": 4.9046,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "15.12717638",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-06-14",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: ACCAGTTG; r: TTGGTACG",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "None",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "not antibiotic treated",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461388",
"accession": "ERS756286",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; not antibiotic treated; oyster from Sylt, translocated from Sylt (D) to Texel (NL)",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel, translocated from Sylt",
"sample-alias": "Cg_115_Hem_Tx_SyC_20120614",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756286/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756286/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756286?format=api"
}
},
{
"type": "samples",
"id": "ERS756287",
"attributes": {
"latitude": 53.1568,
"longitude": 4.9044,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "20.45783428",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-08-24",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: AACGAACG; r: TTGGTACG",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "None",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "not antibiotic treated",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461389",
"accession": "ERS756287",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-08-24; sample taken after field deployment; not antibiotic treated; oyster from Sylt, translocated from Sylt (D) to Texel (NL)",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel, translocated from Sylt",
"sample-alias": "Cg_117_Hem_Tx_SyC_20120824",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756287/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756287/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756287?format=api"
}
},
{
"type": "samples",
"id": "ERS756288",
"attributes": {
"latitude": 53.1567,
"longitude": 4.9046,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "15.12717638",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-06-14",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: AACGAACG; r: TTGGTACG",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "None",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "not antibiotic treated",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461390",
"accession": "ERS756288",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; not antibiotic treated; oyster from Texel, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel",
"sample-alias": "Cg_34_Hem_Tx_TxC_20120614",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756288/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756288/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756288?format=api"
}
},
{
"type": "samples",
"id": "ERS756289",
"attributes": {
"latitude": 53.1569,
"longitude": 4.9042,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "20.45783428",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-08-24",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: GTGAACAG; r: TTGGTACG",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "None",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "not antibiotic treated",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Netherlands, Texel, de Cocksdorp",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461391",
"accession": "ERS756289",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-08-24; sample taken after field deployment; not antibiotic treated; oyster from Texel, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Texel",
"sample-alias": "Cg_50_Hem_Tx_TxC_20120824",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756289/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756289/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756289?format=api"
}
},
{
"type": "samples",
"id": "ERS756290",
"attributes": {
"latitude": 55.0292,
"longitude": 8.4342,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "17.112",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-07-19",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: AGAGGTGT; r: AACCGCAT",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Schleswig Holstein, Sylt, List, Odewatt",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461392",
"accession": "ERS756290",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Sylt, 2012-07-19; sample taken after field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01; oyster from Sylt, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Sylt",
"sample-alias": "Cg_43_Hem_Sy_SyA_20120719",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756290/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756290/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756290?format=api"
}
},
{
"type": "samples",
"id": "ERS756291",
"attributes": {
"latitude": 55.0292,
"longitude": 8.4343,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "temperature",
"value": "14",
"unit": "\\'||chr(38)||\\'deg;C"
},
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "PRJEB9624",
"unit": null
},
{
"key": "collection date",
"value": "2012-06-01",
"unit": null
},
{
"key": "sample collection device or method",
"value": "syringe",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "0.002",
"unit": "L"
},
{
"key": "target gene",
"value": "16s rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V2",
"unit": null
},
{
"key": "pcr primers",
"value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "f: AGAGGTGT; r: AACCGCAT",
"unit": null
},
{
"key": "pcr conditions",
"value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
"unit": null
},
{
"key": "sequencing method",
"value": "Sequencing by synthesis, Illumina paired-end",
"unit": null
},
{
"key": "chemical administration",
"value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
"unit": null
},
{
"key": "host common name",
"value": "Pacific oyster",
"unit": null
},
{
"key": "host taxid",
"value": "29159",
"unit": null
},
{
"key": "perturbation",
"value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "29159",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS host associated (ERC000013)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Schleswig Holstein, Sylt, List, Odewatt",
"unit": null
},
{
"key": "host body habitat",
"value": "hemolymph",
"unit": null
},
{
"key": "host body product",
"value": "NA",
"unit": null
},
{
"key": "host body site",
"value": "adductor muscle",
"unit": null
},
{
"key": "host life stage",
"value": "adult",
"unit": null
},
{
"key": "sample volume or weight for DNA extraction",
"value": "0.2",
"unit": "mL"
},
{
"key": "host-associated environmental package",
"value": "host-associated",
"unit": null
}
],
"biosample": "SAMEA3461393",
"accession": "ERS756291",
"analysis-completed": "2017-03-21",
"collection-date": null,
"geo-loc-name": "North Sea",
"sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Sylt, 2012-06-01; sample taken in the lab, after the treatment and before field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01; oyster from Sylt, not translocated",
"environment-biome": "aquatic, marine, benthic, coastal",
"environment-feature": "organic",
"environment-material": "organic material, bodily fluid",
"sample-name": "Pacific oyster hemolymph microbiota from Sylt",
"sample-alias": "Cg_87_Hem_Sy_SyA_20120601",
"host-tax-id": 29159,
"species": "Crassostrea gigas",
"last-update": "2017-03-21T11:44:24"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Mollusca:Digestive system"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756291/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001607",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756291/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756291?format=api"
}
}
],
"meta": {
"pagination": {
"page": 1,
"pages": 30,
"count": 727
}
}
}