GET /metagenomics/api/v1/studies/MGYS00001607/samples?format=api
HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept

{
    "links": {
        "first": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607/samples?format=api&page=1",
        "last": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607/samples?format=api&page=30",
        "next": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607/samples?format=api&page=2",
        "prev": null
    },
    "data": [
        {
            "type": "samples",
            "id": "ERS756267",
            "attributes": {
                "latitude": 55.0295,
                "longitude": 8.4344,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "14",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-08-15",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: TTCCGGTT; r: AACCGCAT",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Schleswig Holstein, Sylt, List, Odewatt",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461369",
                "accession": "ERS756267",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Sylt, 2012-08-15; sample taken after field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01; oyster from Texel, translocated from Texel (NL) to Sylt (D)",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Sylt, translocated from Texel (NL)",
                "sample-alias": "Cg_72_Hem_Sy_TxA_20120815",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756267/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756267/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756267?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756268",
            "attributes": {
                "latitude": 55.0296,
                "longitude": 8.4343,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "17.112",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-07-19",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: GCTTGCAA; r: AACCGCAT",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Schleswig Holstein, Sylt, List, Odewatt",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461370",
                "accession": "ERS756268",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Sylt, 2012-07-19; sample taken after field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01; oyster from Sylt, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Sylt",
                "sample-alias": "Cg_79_Hem_Sy_SyA_20120719",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756268/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756268/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756268?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756269",
            "attributes": {
                "latitude": 55.0292,
                "longitude": 8.4343,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "14",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-06-01",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: GCTTGCAA; r: AACCGCAT",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "None",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "not antibiotic treated",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Schleswig Holstein, Sylt, List, Odewatt",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461371",
                "accession": "ERS756269",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Sylt, 2012-06-01; sample taken in the lab, after the treatment and before field deployment; not antibiotic treated; oyster from Sylt, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Sylt",
                "sample-alias": "Cg_165_Hem_Sy_SyC_20120601",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756269/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756269/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756269?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756270",
            "attributes": {
                "latitude": 53.1569,
                "longitude": 4.905,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "19.67009995",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-07-27",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: CATGAGGA; r: TCTCGTCA",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461372",
                "accession": "ERS756270",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-07-27; sample taken after field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14; oyster from Sylt, translocated from Sylt (D) to Texel (NL)",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel, translocated from Sylt",
                "sample-alias": "Cg_95_Hem_Tx_SyA_20120727",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756270/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756270/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756270?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756271",
            "attributes": {
                "latitude": 53.1567,
                "longitude": 4.9046,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "15.12717638",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: CAGTTGAC; r: TCTCGTCA",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461373",
                "accession": "ERS756271",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14; oyster from Texel, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel",
                "sample-alias": "Cg_54_Hem_Tx_TxA_20120614",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756271/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756271/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756271?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756272",
            "attributes": {
                "latitude": 53.1567,
                "longitude": 4.9046,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "15.12717638",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: CATGAGGA; r: TCTCGTCA",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461374",
                "accession": "ERS756272",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14; oyster from Texel, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel",
                "sample-alias": "Cg_8_Hem_Tx_TxA_20120614",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756272/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756272/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756272?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756273",
            "attributes": {
                "latitude": 53.1569,
                "longitude": 4.9046,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "19.67009995",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-07-27",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: CTAGTCGA; r: TCTCGTCA",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "None",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "not antibiotic treated",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461375",
                "accession": "ERS756273",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-07-27; sample taken after field deployment; not antibiotic treated; oyster from Texel, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel",
                "sample-alias": "Cg_72_Hem_Tx_TxC_20120727",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756273/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756273/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756273?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756274",
            "attributes": {
                "latitude": 53.1567,
                "longitude": 4.9046,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "15.12717638",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: CTAGTCGA; r: TCTCGTCA",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461376",
                "accession": "ERS756274",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14; oyster from Sylt, translocated from Sylt (D) to Texel (NL)",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel, translocated from Sylt",
                "sample-alias": "Cg_27_Hem_Tx_SyA_20120614",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756274/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756274/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756274?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756275",
            "attributes": {
                "latitude": 53.1564,
                "longitude": 4.9046,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "19.67009995",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-07-27",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: GCTTGCAA; r: TCTCGTCA",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "None",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "not antibiotic treated",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461377",
                "accession": "ERS756275",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-07-27; sample taken after field deployment; not antibiotic treated; oyster from Texel, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel",
                "sample-alias": "Cg_84_Hem_Tx_TxC_20120727",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756275/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756275/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756275?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756276",
            "attributes": {
                "latitude": 53.1564,
                "longitude": 4.9046,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "19.67009995",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-07-27",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: AGAGGTGT; r: TCTCGTCA",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "None",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "not antibiotic treated",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461378",
                "accession": "ERS756276",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-07-27; sample taken after field deployment; not antibiotic treated; oyster from Sylt, translocated from Sylt (D) to Texel (NL)",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel, translocated from Sylt",
                "sample-alias": "Cg_47_Hem_Tx_SyC_20120727",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756276/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756276/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756276?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756277",
            "attributes": {
                "latitude": 53.1567,
                "longitude": 4.9046,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "15.12717638",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: GCTTGCAA; r: TCTCGTCA",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461379",
                "accession": "ERS756277",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14; oyster from Texel, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel",
                "sample-alias": "Cg_104_Hem_Tx_TxA_20120614",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756277/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756277/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756277?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756278",
            "attributes": {
                "latitude": 53.1567,
                "longitude": 4.9046,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "15.12717638",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: AGAGGTGT; r: TCTCGTCA",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461380",
                "accession": "ERS756278",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14; oyster from Texel, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel",
                "sample-alias": "Cg_90_Hem_Tx_TxA_20120614",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756278/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756278/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756278?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756279",
            "attributes": {
                "latitude": 53.1568,
                "longitude": 4.9048,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "19.67009995",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-07-27",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: GCTACGAT; r: TCTCGTCA",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "None",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "not antibiotic treated",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461381",
                "accession": "ERS756279",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-07-27; sample taken after field deployment; not antibiotic treated; oyster from Texel, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel",
                "sample-alias": "Cg_74_Hem_Tx_TxC_20120727",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756279/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756279/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756279?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756280",
            "attributes": {
                "latitude": 53.1567,
                "longitude": 4.9046,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "15.12717638",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: GCTACGAT; r: TCTCGTCA",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461382",
                "accession": "ERS756280",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-06-11 and 2012-06-14; oyster from Sylt, translocated from Sylt (D) to Texel (NL)",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel, translocated from Sylt",
                "sample-alias": "Cg_79_Hem_Tx_SyA_20120614",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756280/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756280/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756280?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756281",
            "attributes": {
                "latitude": 53.1568,
                "longitude": 4.9048,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "20.45783428",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-08-24",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: TTCCGGTT; r: TTGGTACG",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "None",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "not antibiotic treated",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461383",
                "accession": "ERS756281",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-08-24; sample taken after field deployment; not antibiotic treated; oyster from Texel, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel",
                "sample-alias": "Cg_74_Hem_Tx_TxC_20120824",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756281/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756281/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756281?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756282",
            "attributes": {
                "latitude": 53.1567,
                "longitude": 4.9046,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "15.12717638",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: TTCCGGTT; r: TTGGTACG",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "None",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "not antibiotic treated",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461384",
                "accession": "ERS756282",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; not antibiotic treated; oyster from Texel, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel",
                "sample-alias": "Cg_28_Hem_Tx_TxC_20120614",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756282/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756282/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756282?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756283",
            "attributes": {
                "latitude": 53.1569,
                "longitude": 4.9046,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "20.45783428",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-08-24",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: GTCACTCT; r: TTGGTACG",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "None",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "not antibiotic treated",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461385",
                "accession": "ERS756283",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-08-24; sample taken after field deployment; not antibiotic treated; oyster from Texel, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel",
                "sample-alias": "Cg_18_Hem_Tx_TxC_20120824",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756283/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756283/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756283?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756284",
            "attributes": {
                "latitude": 53.1569,
                "longitude": 4.9046,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "20.45783428",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-08-24",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: ACCAGTTG; r: TTGGTACG",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "None",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "not antibiotic treated",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461386",
                "accession": "ERS756284",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-08-24; sample taken after field deployment; not antibiotic treated; oyster from Sylt, translocated from Sylt (D) to Texel (NL)",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel, translocated from Sylt",
                "sample-alias": "Cg_103_Hem_Tx_SyC_20120824",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756284/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756284/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756284?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756285",
            "attributes": {
                "latitude": 53.1567,
                "longitude": 4.9046,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "15.12717638",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: GTCACTCT; r: TTGGTACG",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "None",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "not antibiotic treated",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461387",
                "accession": "ERS756285",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; not antibiotic treated; oyster from Texel, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel",
                "sample-alias": "Cg_24_Hem_Tx_TxC_20120614",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756285/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756285/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756285?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756286",
            "attributes": {
                "latitude": 53.1567,
                "longitude": 4.9046,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "15.12717638",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: ACCAGTTG; r: TTGGTACG",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "None",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "not antibiotic treated",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461388",
                "accession": "ERS756286",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; not antibiotic treated; oyster from Sylt, translocated from Sylt (D) to Texel (NL)",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel, translocated from Sylt",
                "sample-alias": "Cg_115_Hem_Tx_SyC_20120614",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756286/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756286/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756286?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756287",
            "attributes": {
                "latitude": 53.1568,
                "longitude": 4.9044,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "20.45783428",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-08-24",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: AACGAACG; r: TTGGTACG",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "None",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "not antibiotic treated",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461389",
                "accession": "ERS756287",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-08-24; sample taken after field deployment; not antibiotic treated; oyster from Sylt, translocated from Sylt (D) to Texel (NL)",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel, translocated from Sylt",
                "sample-alias": "Cg_117_Hem_Tx_SyC_20120824",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756287/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756287/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756287?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756288",
            "attributes": {
                "latitude": 53.1567,
                "longitude": 4.9046,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "15.12717638",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-06-14",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: AACGAACG; r: TTGGTACG",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "None",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "not antibiotic treated",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461390",
                "accession": "ERS756288",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-14; sample taken in the lab, after the treatment and before field deployment; not antibiotic treated; oyster from Texel, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel",
                "sample-alias": "Cg_34_Hem_Tx_TxC_20120614",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756288/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756288/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756288?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756289",
            "attributes": {
                "latitude": 53.1569,
                "longitude": 4.9042,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "20.45783428",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-08-24",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: GTGAACAG; r: TTGGTACG",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "None",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "not antibiotic treated",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Netherlands, Texel, de Cocksdorp",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461391",
                "accession": "ERS756289",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-08-24; sample taken after field deployment; not antibiotic treated; oyster from Texel, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Texel",
                "sample-alias": "Cg_50_Hem_Tx_TxC_20120824",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756289/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756289/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756289?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756290",
            "attributes": {
                "latitude": 55.0292,
                "longitude": 8.4342,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "17.112",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-07-19",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: AGAGGTGT; r: AACCGCAT",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Schleswig Holstein, Sylt, List, Odewatt",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461392",
                "accession": "ERS756290",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Sylt, 2012-07-19; sample taken after field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01; oyster from Sylt, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Sylt",
                "sample-alias": "Cg_43_Hem_Sy_SyA_20120719",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756290/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756290/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756290?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS756291",
            "attributes": {
                "latitude": 55.0292,
                "longitude": 8.4343,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-80",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "temperature",
                        "value": "14",
                        "unit": "\\'||chr(38)||\\'deg;C"
                    },
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "PRJEB9624",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-06-01",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "syringe",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "0.002",
                        "unit": "L"
                    },
                    {
                        "key": "target gene",
                        "value": "16s rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V2",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "f: AGAGGTGT; r: AACCGCAT",
                        "unit": null
                    },
                    {
                        "key": "pcr conditions",
                        "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Sequencing by synthesis, Illumina paired-end",
                        "unit": null
                    },
                    {
                        "key": "chemical administration",
                        "value": "Mix of ampiciline, gentamicine, tetracycline and kanamycine, each 100 µg/l seawater each",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Pacific oyster",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "perturbation",
                        "value": "treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "29159",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS host associated (ERC000013)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Schleswig Holstein, Sylt, List, Odewatt",
                        "unit": null
                    },
                    {
                        "key": "host body habitat",
                        "value": "hemolymph",
                        "unit": null
                    },
                    {
                        "key": "host body product",
                        "value": "NA",
                        "unit": null
                    },
                    {
                        "key": "host body site",
                        "value": "adductor muscle",
                        "unit": null
                    },
                    {
                        "key": "host life stage",
                        "value": "adult",
                        "unit": null
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "0.2",
                        "unit": "mL"
                    },
                    {
                        "key": "host-associated environmental package",
                        "value": "host-associated",
                        "unit": null
                    }
                ],
                "biosample": "SAMEA3461393",
                "accession": "ERS756291",
                "analysis-completed": "2017-03-21",
                "collection-date": null,
                "geo-loc-name": "North Sea",
                "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Sylt, 2012-06-01; sample taken in the lab, after the treatment and before field deployment; treated with mix of ampiciline, gentamicine, tetracycline and kanamycine (100 µg/l seawater each) between 2012-05-29 and 2012-06-01; oyster from Sylt, not translocated",
                "environment-biome": "aquatic, marine, benthic, coastal",
                "environment-feature": "organic",
                "environment-material": "organic material, bodily fluid",
                "sample-name": "Pacific oyster hemolymph microbiota from Sylt",
                "sample-alias": "Cg_87_Hem_Sy_SyA_20120601",
                "host-tax-id": 29159,
                "species": "Crassostrea gigas",
                "last-update": "2017-03-21T11:44:24"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Mollusca:Digestive system"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756291/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001607",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756291/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756291?format=api"
            }
        }
    ],
    "meta": {
        "pagination": {
            "page": 1,
            "pages": 30,
            "count": 727
        }
    }
}