GET /metagenomics/api/v1/studies/MGYS00001602/samples?format=api
HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept

{
    "links": {
        "first": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602/samples?format=api&page=1",
        "last": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602/samples?format=api&page=1",
        "next": null,
        "prev": null
    },
    "data": [
        {
            "type": "samples",
            "id": "ERS739685",
            "attributes": {
                "longitude": 21.4833,
                "biosample": "SAMEA3416688",
                "latitude": 61.2333,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "N-SIP",
                        "unit": null
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "21.483333",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "100",
                        "unit": "m"
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Finland",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-05-12",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "deep subsurface",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "crystalline bedrock",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "groundwater",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "VLJ-KR9",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "borehole",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "2.4",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "v1v3",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "fD1, P2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "AGCAGC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "5.28",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "76.3",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "513",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "236000",
                        "unit": "µg/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.06",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "61.233333",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "77133",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "ERC000024",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "2.26",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "2400",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "accession": "ERS739685",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "VLJ-KR9_15NO3_SIP",
                "sample-alias": "VLJ-KR9_15NO3_SIP",
                "host-tax-id": null,
                "species": null,
                "last-update": "2024-01-25T16:40:28"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Aquatic:Freshwater:Groundwater"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739685/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001602",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739685/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739685?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS739688",
            "attributes": {
                "longitude": 21.4833,
                "biosample": "SAMEA3416691",
                "latitude": 61.2333,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "N-SIP",
                        "unit": null
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "21.483333",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "100",
                        "unit": "m"
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Finland",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-05-12",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "deep subsurface",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "crystalline bedrock",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "groundwater",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "VLJ-KR9",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "borehole",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "2.4",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "v1v3",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "fD1, P2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TCTGTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "5.28",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "76.3",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "513",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "236000",
                        "unit": "µg/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.06",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "61.233333",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "77133",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "ERC000024",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "2.26",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "2400",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "accession": "ERS739688",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "VLJ-KR9_NH4CH4_Enrichment",
                "sample-alias": "VLJ-KR9_NH4CH4_Enrichment",
                "host-tax-id": null,
                "species": null,
                "last-update": "2024-01-25T16:40:10"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Aquatic:Freshwater:Groundwater"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739688/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001602",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739688/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739688?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS739689",
            "attributes": {
                "longitude": 21.4833,
                "biosample": "SAMEA3416692",
                "latitude": 61.2333,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "N-SIP",
                        "unit": null
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "21.483333",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "100",
                        "unit": "m"
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Finland",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-05-12",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "deep subsurface",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "crystalline bedrock",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "groundwater",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "VLJ-KR9",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "borehole",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "2.4",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "v1v3",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "fD1, P2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "AGCAGC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "5.28",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "76.3",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "513",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "236000",
                        "unit": "µg/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.06",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "61.233333",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "77133",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "ERC000024",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "2.26",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "2400",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "accession": "ERS739689",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "VLJ-KR9_NO3_Enrichment",
                "sample-alias": "VLJ-KR9_NO3_Enrichment",
                "host-tax-id": null,
                "species": null,
                "last-update": "2024-01-25T16:39:53"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Aquatic:Freshwater:Groundwater"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739689/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001602",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739689/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739689?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS739681",
            "attributes": {
                "longitude": 21.4833,
                "biosample": "SAMEA3416684",
                "latitude": 61.2333,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "N-SIP",
                        "unit": null
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "21.483333",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "100",
                        "unit": "m"
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Finland",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-05-12",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "deep subsurface",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "crystalline bedrock",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "groundwater",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "VLJ-KR9",
                        "unit": null
                    },
                    {
                        "key": "relationship to oxygen",
                        "value": "anaerobe",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "borehole",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "2.4",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "v1v3",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "fD1, P2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TGAGCA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "5.28",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "76.3",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "513",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "236000",
                        "unit": "µg/L"
                    },
                    {
                        "key": "oxygenation status of sample",
                        "value": "anaerobic",
                        "unit": null
                    },
                    {
                        "key": "pH",
                        "value": "7.06",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "61.233333",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "77133",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "ERC000024",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "2.26",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "2400",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "accession": "ERS739681",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "VLJ-KR9_Start",
                "sample-alias": "VLJ-KR9_Start",
                "host-tax-id": null,
                "species": null,
                "last-update": "2024-01-25T16:39:36"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Aquatic:Freshwater:Groundwater"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739681/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001602",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739681/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739681?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS739683",
            "attributes": {
                "longitude": 21.4833,
                "biosample": "SAMEA3416686",
                "latitude": 61.2333,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "N-SIP",
                        "unit": null
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "21.483333",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "100",
                        "unit": "m"
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Finland",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-05-12",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "deep subsurface",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "crystalline bedrock",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "groundwater",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "VLJ-KR9",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "borehole",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "2.4",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "v1v3",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "fD1, P2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TAGCTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "5.28",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "76.3",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "513",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "236000",
                        "unit": "µg/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.06",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "61.233333",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "77133",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "ERC000024",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "2.26",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "2400",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "accession": "ERS739683",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "VLJ-KR9_15NH4_SIP",
                "sample-alias": "VLJ-KR9_15NH4_SIP",
                "host-tax-id": null,
                "species": null,
                "last-update": "2024-01-25T16:39:20"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Aquatic:Freshwater:Groundwater"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739683/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001602",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739683/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739683?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS739684",
            "attributes": {
                "longitude": 21.4833,
                "biosample": "SAMEA3416687",
                "latitude": 61.2333,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "N-SIP",
                        "unit": null
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "21.483333",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "100",
                        "unit": "m"
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Finland",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-05-12",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "deep subsurface",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "crystalline bedrock",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "groundwater",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "VLJ-KR9",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "borehole",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "2.4",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "v1v3",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "fD1, P2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TCTGTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "5.28",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "76.3",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "513",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "236000",
                        "unit": "µg/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.06",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "61.233333",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "77133",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "ERC000024",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "2.26",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "2400",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "accession": "ERS739684",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "VLJ-KR9_15NH4CH4_SIP",
                "sample-alias": "VLJ-KR9_15NH4CH4_SIP",
                "host-tax-id": null,
                "species": null,
                "last-update": "2024-01-25T16:39:04"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Aquatic:Freshwater:Groundwater"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739684/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001602",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739684/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739684?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS739682",
            "attributes": {
                "longitude": 21.4833,
                "biosample": "SAMEA3416685",
                "latitude": 61.2333,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "N-SIP",
                        "unit": null
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "21.483333",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "100",
                        "unit": "m"
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Finland",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-05-12",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "deep subsurface",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "crystalline bedrock",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "groundwater",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "VLJ-KR9",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "borehole",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "2.4",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "v1v3",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "fD1, P2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "gctgtc",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "5.28",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "76.3",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "513",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "236000",
                        "unit": "µg/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.06",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "61.233333",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "77133",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "ERC000024",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "2.26",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "2400",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "accession": "ERS739682",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "VLJ-KR9_Stop",
                "sample-alias": "VLJ-KR9_Stop",
                "host-tax-id": null,
                "species": null,
                "last-update": "2024-01-25T16:38:46"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Aquatic:Freshwater:Groundwater"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739682/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001602",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739682/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739682?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS739686",
            "attributes": {
                "longitude": 21.4833,
                "biosample": "SAMEA3416689",
                "latitude": 61.2333,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "N-SIP",
                        "unit": null
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "21.483333",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "100",
                        "unit": "m"
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Finland",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-05-12",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "deep subsurface",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "crystalline bedrock",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "groundwater",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "VLJ-KR9",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "borehole",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "2.4",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "v1v3",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "fD1, P2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TACAGC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "5.28",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "76.3",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "513",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "236000",
                        "unit": "µg/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.06",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "61.233333",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "77133",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "ERC000024",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "2.26",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "2400",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "accession": "ERS739686",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "VLJ-KR9_15NO3CH4_SIP",
                "sample-alias": "VLJ-KR9_15NO3CH4_SIP",
                "host-tax-id": null,
                "species": null,
                "last-update": "2024-01-25T16:38:29"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Aquatic:Freshwater:Groundwater"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739686/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001602",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739686/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739686?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS739690",
            "attributes": {
                "longitude": 21.4833,
                "biosample": "SAMEA3416693",
                "latitude": 61.2333,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "N-SIP",
                        "unit": null
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "21.483333",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "100",
                        "unit": "m"
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Finland",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-05-12",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "deep subsurface",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "crystalline bedrock",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "groundwater",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "VLJ-KR9",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "borehole",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "2.4",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "v1v3",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "fD1, P2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TACAGC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "5.28",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "76.3",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "513",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "236000",
                        "unit": "µg/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.06",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "61.233333",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "77133",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "ERC000024",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "2.26",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "2400",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "accession": "ERS739690",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "VLJ-KR9_NO3CH4_Enrichment",
                "sample-alias": "VLJ-KR9_NO3CH4_Enrichment",
                "host-tax-id": null,
                "species": null,
                "last-update": "2024-01-25T16:38:11"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Aquatic:Freshwater:Groundwater"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739690/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001602",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739690/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739690?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS739687",
            "attributes": {
                "longitude": 21.4833,
                "biosample": "SAMEA3416690",
                "latitude": 61.2333,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "N-SIP",
                        "unit": null
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "21.483333",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "100",
                        "unit": "m"
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Finland",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2012-05-12",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "deep subsurface",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "crystalline bedrock",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "groundwater",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "VLJ-KR9",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "borehole",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "2.4",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "v1v3",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "fD1, P2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TAGCTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "5.28",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "76.3",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "513",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "236000",
                        "unit": "µg/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.06",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "61.233333",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "77133",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "ERC000024",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "2.26",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "2400",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "accession": "ERS739687",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "VLJ-KR9_NH4_Enrichment",
                "sample-alias": "VLJ-KR9_NH4_Enrichment",
                "host-tax-id": null,
                "species": null,
                "last-update": "2024-01-25T16:37:53"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Aquatic:Freshwater:Groundwater"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739687/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001602",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739687/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739687?format=api"
            }
        }
    ],
    "meta": {
        "pagination": {
            "page": 1,
            "pages": 1,
            "count": 10
        }
    }
}