HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept
{
"links": {
"first": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602/samples?format=api&page=1",
"last": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602/samples?format=api&page=1",
"next": null,
"prev": null
},
"data": [
{
"type": "samples",
"id": "ERS739685",
"attributes": {
"longitude": 21.4833,
"biosample": "SAMEA3416688",
"latitude": 61.2333,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "N-SIP",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "21.483333",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "100",
"unit": "m"
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Finland",
"unit": null
},
{
"key": "collection date",
"value": "2012-05-12",
"unit": null
},
{
"key": "environment (biome)",
"value": "deep subsurface",
"unit": null
},
{
"key": "environment (feature)",
"value": "crystalline bedrock",
"unit": null
},
{
"key": "environment (material)",
"value": "groundwater",
"unit": null
},
{
"key": "source material identifiers",
"value": "VLJ-KR9",
"unit": null
},
{
"key": "sample collection device or method",
"value": "borehole",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "2.4",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "v1v3",
"unit": null
},
{
"key": "pcr primers",
"value": "fD1, P2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "AGCAGC",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "5.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "76.3",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "513",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "236000",
"unit": "µg/L"
},
{
"key": "pH",
"value": "7.06",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "61.233333",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "ERC000024",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2.26",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "2400",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS739685",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "VLJ-KR9_15NO3_SIP",
"sample-alias": "VLJ-KR9_15NO3_SIP",
"host-tax-id": null,
"species": null,
"last-update": "2024-01-25T16:40:28"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739685/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001602",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739685/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739685?format=api"
}
},
{
"type": "samples",
"id": "ERS739688",
"attributes": {
"longitude": 21.4833,
"biosample": "SAMEA3416691",
"latitude": 61.2333,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "N-SIP",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "21.483333",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "100",
"unit": "m"
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Finland",
"unit": null
},
{
"key": "collection date",
"value": "2012-05-12",
"unit": null
},
{
"key": "environment (biome)",
"value": "deep subsurface",
"unit": null
},
{
"key": "environment (feature)",
"value": "crystalline bedrock",
"unit": null
},
{
"key": "environment (material)",
"value": "groundwater",
"unit": null
},
{
"key": "source material identifiers",
"value": "VLJ-KR9",
"unit": null
},
{
"key": "sample collection device or method",
"value": "borehole",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "2.4",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "v1v3",
"unit": null
},
{
"key": "pcr primers",
"value": "fD1, P2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TCTGTA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "5.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "76.3",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "513",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "236000",
"unit": "µg/L"
},
{
"key": "pH",
"value": "7.06",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "61.233333",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "ERC000024",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2.26",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "2400",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS739688",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "VLJ-KR9_NH4CH4_Enrichment",
"sample-alias": "VLJ-KR9_NH4CH4_Enrichment",
"host-tax-id": null,
"species": null,
"last-update": "2024-01-25T16:40:10"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739688/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001602",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739688/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739688?format=api"
}
},
{
"type": "samples",
"id": "ERS739689",
"attributes": {
"longitude": 21.4833,
"biosample": "SAMEA3416692",
"latitude": 61.2333,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "N-SIP",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "21.483333",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "100",
"unit": "m"
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Finland",
"unit": null
},
{
"key": "collection date",
"value": "2012-05-12",
"unit": null
},
{
"key": "environment (biome)",
"value": "deep subsurface",
"unit": null
},
{
"key": "environment (feature)",
"value": "crystalline bedrock",
"unit": null
},
{
"key": "environment (material)",
"value": "groundwater",
"unit": null
},
{
"key": "source material identifiers",
"value": "VLJ-KR9",
"unit": null
},
{
"key": "sample collection device or method",
"value": "borehole",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "2.4",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "v1v3",
"unit": null
},
{
"key": "pcr primers",
"value": "fD1, P2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "AGCAGC",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "5.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "76.3",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "513",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "236000",
"unit": "µg/L"
},
{
"key": "pH",
"value": "7.06",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "61.233333",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "ERC000024",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2.26",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "2400",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS739689",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "VLJ-KR9_NO3_Enrichment",
"sample-alias": "VLJ-KR9_NO3_Enrichment",
"host-tax-id": null,
"species": null,
"last-update": "2024-01-25T16:39:53"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739689/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001602",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739689/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739689?format=api"
}
},
{
"type": "samples",
"id": "ERS739681",
"attributes": {
"longitude": 21.4833,
"biosample": "SAMEA3416684",
"latitude": 61.2333,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "N-SIP",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "21.483333",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "100",
"unit": "m"
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Finland",
"unit": null
},
{
"key": "collection date",
"value": "2012-05-12",
"unit": null
},
{
"key": "environment (biome)",
"value": "deep subsurface",
"unit": null
},
{
"key": "environment (feature)",
"value": "crystalline bedrock",
"unit": null
},
{
"key": "environment (material)",
"value": "groundwater",
"unit": null
},
{
"key": "source material identifiers",
"value": "VLJ-KR9",
"unit": null
},
{
"key": "relationship to oxygen",
"value": "anaerobe",
"unit": null
},
{
"key": "sample collection device or method",
"value": "borehole",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "2.4",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "v1v3",
"unit": null
},
{
"key": "pcr primers",
"value": "fD1, P2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TGAGCA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "5.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "76.3",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "513",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "236000",
"unit": "µg/L"
},
{
"key": "oxygenation status of sample",
"value": "anaerobic",
"unit": null
},
{
"key": "pH",
"value": "7.06",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "61.233333",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "ERC000024",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2.26",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "2400",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS739681",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "VLJ-KR9_Start",
"sample-alias": "VLJ-KR9_Start",
"host-tax-id": null,
"species": null,
"last-update": "2024-01-25T16:39:36"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739681/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001602",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739681/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739681?format=api"
}
},
{
"type": "samples",
"id": "ERS739683",
"attributes": {
"longitude": 21.4833,
"biosample": "SAMEA3416686",
"latitude": 61.2333,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "N-SIP",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "21.483333",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "100",
"unit": "m"
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Finland",
"unit": null
},
{
"key": "collection date",
"value": "2012-05-12",
"unit": null
},
{
"key": "environment (biome)",
"value": "deep subsurface",
"unit": null
},
{
"key": "environment (feature)",
"value": "crystalline bedrock",
"unit": null
},
{
"key": "environment (material)",
"value": "groundwater",
"unit": null
},
{
"key": "source material identifiers",
"value": "VLJ-KR9",
"unit": null
},
{
"key": "sample collection device or method",
"value": "borehole",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "2.4",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "v1v3",
"unit": null
},
{
"key": "pcr primers",
"value": "fD1, P2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TAGCTA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "5.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "76.3",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "513",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "236000",
"unit": "µg/L"
},
{
"key": "pH",
"value": "7.06",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "61.233333",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "ERC000024",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2.26",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "2400",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS739683",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "VLJ-KR9_15NH4_SIP",
"sample-alias": "VLJ-KR9_15NH4_SIP",
"host-tax-id": null,
"species": null,
"last-update": "2024-01-25T16:39:20"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739683/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001602",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739683/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739683?format=api"
}
},
{
"type": "samples",
"id": "ERS739684",
"attributes": {
"longitude": 21.4833,
"biosample": "SAMEA3416687",
"latitude": 61.2333,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "N-SIP",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "21.483333",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "100",
"unit": "m"
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Finland",
"unit": null
},
{
"key": "collection date",
"value": "2012-05-12",
"unit": null
},
{
"key": "environment (biome)",
"value": "deep subsurface",
"unit": null
},
{
"key": "environment (feature)",
"value": "crystalline bedrock",
"unit": null
},
{
"key": "environment (material)",
"value": "groundwater",
"unit": null
},
{
"key": "source material identifiers",
"value": "VLJ-KR9",
"unit": null
},
{
"key": "sample collection device or method",
"value": "borehole",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "2.4",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "v1v3",
"unit": null
},
{
"key": "pcr primers",
"value": "fD1, P2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TCTGTA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "5.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "76.3",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "513",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "236000",
"unit": "µg/L"
},
{
"key": "pH",
"value": "7.06",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "61.233333",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "ERC000024",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2.26",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "2400",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS739684",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "VLJ-KR9_15NH4CH4_SIP",
"sample-alias": "VLJ-KR9_15NH4CH4_SIP",
"host-tax-id": null,
"species": null,
"last-update": "2024-01-25T16:39:04"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739684/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001602",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739684/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739684?format=api"
}
},
{
"type": "samples",
"id": "ERS739682",
"attributes": {
"longitude": 21.4833,
"biosample": "SAMEA3416685",
"latitude": 61.2333,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "N-SIP",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "21.483333",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "100",
"unit": "m"
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Finland",
"unit": null
},
{
"key": "collection date",
"value": "2012-05-12",
"unit": null
},
{
"key": "environment (biome)",
"value": "deep subsurface",
"unit": null
},
{
"key": "environment (feature)",
"value": "crystalline bedrock",
"unit": null
},
{
"key": "environment (material)",
"value": "groundwater",
"unit": null
},
{
"key": "source material identifiers",
"value": "VLJ-KR9",
"unit": null
},
{
"key": "sample collection device or method",
"value": "borehole",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "2.4",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "v1v3",
"unit": null
},
{
"key": "pcr primers",
"value": "fD1, P2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "gctgtc",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "5.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "76.3",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "513",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "236000",
"unit": "µg/L"
},
{
"key": "pH",
"value": "7.06",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "61.233333",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "ERC000024",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2.26",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "2400",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS739682",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "VLJ-KR9_Stop",
"sample-alias": "VLJ-KR9_Stop",
"host-tax-id": null,
"species": null,
"last-update": "2024-01-25T16:38:46"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739682/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001602",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739682/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739682?format=api"
}
},
{
"type": "samples",
"id": "ERS739686",
"attributes": {
"longitude": 21.4833,
"biosample": "SAMEA3416689",
"latitude": 61.2333,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "N-SIP",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "21.483333",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "100",
"unit": "m"
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Finland",
"unit": null
},
{
"key": "collection date",
"value": "2012-05-12",
"unit": null
},
{
"key": "environment (biome)",
"value": "deep subsurface",
"unit": null
},
{
"key": "environment (feature)",
"value": "crystalline bedrock",
"unit": null
},
{
"key": "environment (material)",
"value": "groundwater",
"unit": null
},
{
"key": "source material identifiers",
"value": "VLJ-KR9",
"unit": null
},
{
"key": "sample collection device or method",
"value": "borehole",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "2.4",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "v1v3",
"unit": null
},
{
"key": "pcr primers",
"value": "fD1, P2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TACAGC",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "5.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "76.3",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "513",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "236000",
"unit": "µg/L"
},
{
"key": "pH",
"value": "7.06",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "61.233333",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "ERC000024",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2.26",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "2400",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS739686",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "VLJ-KR9_15NO3CH4_SIP",
"sample-alias": "VLJ-KR9_15NO3CH4_SIP",
"host-tax-id": null,
"species": null,
"last-update": "2024-01-25T16:38:29"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739686/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001602",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739686/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739686?format=api"
}
},
{
"type": "samples",
"id": "ERS739690",
"attributes": {
"longitude": 21.4833,
"biosample": "SAMEA3416693",
"latitude": 61.2333,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "N-SIP",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "21.483333",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "100",
"unit": "m"
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Finland",
"unit": null
},
{
"key": "collection date",
"value": "2012-05-12",
"unit": null
},
{
"key": "environment (biome)",
"value": "deep subsurface",
"unit": null
},
{
"key": "environment (feature)",
"value": "crystalline bedrock",
"unit": null
},
{
"key": "environment (material)",
"value": "groundwater",
"unit": null
},
{
"key": "source material identifiers",
"value": "VLJ-KR9",
"unit": null
},
{
"key": "sample collection device or method",
"value": "borehole",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "2.4",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "v1v3",
"unit": null
},
{
"key": "pcr primers",
"value": "fD1, P2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TACAGC",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "5.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "76.3",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "513",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "236000",
"unit": "µg/L"
},
{
"key": "pH",
"value": "7.06",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "61.233333",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "ERC000024",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2.26",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "2400",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS739690",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "VLJ-KR9_NO3CH4_Enrichment",
"sample-alias": "VLJ-KR9_NO3CH4_Enrichment",
"host-tax-id": null,
"species": null,
"last-update": "2024-01-25T16:38:11"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739690/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001602",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739690/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739690?format=api"
}
},
{
"type": "samples",
"id": "ERS739687",
"attributes": {
"longitude": 21.4833,
"biosample": "SAMEA3416690",
"latitude": 61.2333,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "N-SIP",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "21.483333",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "100",
"unit": "m"
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Finland",
"unit": null
},
{
"key": "collection date",
"value": "2012-05-12",
"unit": null
},
{
"key": "environment (biome)",
"value": "deep subsurface",
"unit": null
},
{
"key": "environment (feature)",
"value": "crystalline bedrock",
"unit": null
},
{
"key": "environment (material)",
"value": "groundwater",
"unit": null
},
{
"key": "source material identifiers",
"value": "VLJ-KR9",
"unit": null
},
{
"key": "sample collection device or method",
"value": "borehole",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "2.4",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "v1v3",
"unit": null
},
{
"key": "pcr primers",
"value": "fD1, P2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TAGCTA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "5.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "76.3",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "513",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "236000",
"unit": "µg/L"
},
{
"key": "pH",
"value": "7.06",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "61.233333",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "ERC000024",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "2.26",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "2400",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"accession": "ERS739687",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "VLJ-KR9_NH4_Enrichment",
"sample-alias": "VLJ-KR9_NH4_Enrichment",
"host-tax-id": null,
"species": null,
"last-update": "2024-01-25T16:37:53"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Freshwater:Groundwater"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Freshwater:Groundwater?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739687/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001602",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001602?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739687/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS739687?format=api"
}
}
],
"meta": {
"pagination": {
"page": 1,
"pages": 1,
"count": 10
}
}
}