GET /metagenomics/api/v1/studies/MGYS00001597/samples?format=api
HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept

{
    "links": {
        "first": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597/samples?format=api&page=1",
        "last": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597/samples?format=api&page=2",
        "next": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597/samples?format=api&page=2",
        "prev": null
    },
    "data": [
        {
            "type": "samples",
            "id": "ERS706390",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "296",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2010-01-23",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR13/296m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "CTGCTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "2.19",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "460",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "2920",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "27",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "10",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "35",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.9",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "8970",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344960",
                "longitude": 21.4833,
                "accession": "ERS706390",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR13/296m_10",
                "sample-alias": "I362KR13DNA10",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706390/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706390/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706390?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706391",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "296",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2010-09-03",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR13/296m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TAGTAT",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "2.19",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "460",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "2920",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "27",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "10",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "35",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.9",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "8970",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344961",
                "longitude": 21.4833,
                "accession": "ERS706391",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR13/296m_10",
                "sample-alias": "I362KR13RNA10",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706391/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706391/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706391?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706392",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "296",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2012-08-21",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR13/296m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TATGTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "1.9",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "380",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "2540",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "28",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "38",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "35",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.8",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "8070",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344962",
                "longitude": 21.4833,
                "accession": "ERS706392",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR13/296m_12",
                "sample-alias": "I360KR13DNA12",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706392/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706392/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706392?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706393",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "296",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2012-08-21",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR13/296m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TATAGA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "1.9",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "380",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "2540",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "28",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "38",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "35",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.8",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "8070",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344963",
                "longitude": 21.4833,
                "accession": "ERS706393",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR13/296m_12",
                "sample-alias": "I360KR13RNA12",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706393/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706393/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706393?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706394",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "303",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2012-08-21",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR3/303m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TAGCGC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.42",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "350",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "3280",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "4.3",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "7.8",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "28",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "9870",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344964",
                "longitude": 21.4833,
                "accession": "ERS706394",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR3/303m_12",
                "sample-alias": "I339KR03DNA12",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706394/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706394/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706394?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706395",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "303",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2012-08-21",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR3/303m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TACTCG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.42",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "350",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "3280",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "4.3",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "7.8",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "28",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "9870",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344965",
                "longitude": 21.4833,
                "accession": "ERS706395",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR3/303m_12",
                "sample-alias": "I339KR03RNA12",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706395/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706395/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706395?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706396",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "323",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-21",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR20/323m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATAGTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "1.1",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "530",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "3790",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "13",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "11",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "52",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.7",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "11160",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344966",
                "longitude": 21.4833,
                "accession": "ERS706396",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR20/323m_13",
                "sample-alias": "I410KR20DNA13",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706396/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706396/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706396?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706397",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "323",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-21",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR20/323m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ACTCAG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "1.1",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "530",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "3790",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "13",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "11",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "52",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.7",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "11160",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344967",
                "longitude": 21.4833,
                "accession": "ERS706397",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR20/323m_13",
                "sample-alias": "I410KR20RNA13",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706397/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706397/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706397?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706398",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "328",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2010-05-18",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR6/328m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TACTCG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.37",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "1100",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "6230",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "4.1",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "77",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.9",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "18320",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344968",
                "longitude": 21.4833,
                "accession": "ERS706398",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR6/328m_10",
                "sample-alias": "I422KR06DNA10",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706398/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706398/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706398?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706399",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "328",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2010-05-18",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR6/328m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TAGCGC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.37",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "1100",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "6230",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "4.1",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "77",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.9",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "18320",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344969",
                "longitude": 21.4833,
                "accession": "ERS706399",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR6/328m_10",
                "sample-alias": "I422KR06RNA10",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706399/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706399/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706399?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706400",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "330",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-20",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR6/330m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TAGCGC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.45",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "1090",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "6160",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "4.6",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "89",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "18000",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344970",
                "longitude": 21.4833,
                "accession": "ERS706400",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR6/330m_13",
                "sample-alias": "I422KR06DNA13",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706400/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706400/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706400?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706401",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "330",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-20",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR6/330m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TACTCG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "2.8",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "355",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "1940",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "33",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "13",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "29",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.9",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "6420",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344971",
                "longitude": 21.4833,
                "accession": "ERS706401",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR6/330m_13",
                "sample-alias": "I422KR06RNA13",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706401/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706401/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706401?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706402",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "330",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2011-10-31",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR25/330m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ACTCAG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "2.8",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "355",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "1940",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "33",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "13",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "29",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.9",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "6420",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344972",
                "longitude": 21.4833,
                "accession": "ERS706402",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR25/330m_11",
                "sample-alias": "I357KR25DNA11",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706402/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706402/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706402?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706403",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "330",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2011-10-31",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR25/330m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TAGTAT",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.41",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "290",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "3400",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "4.1",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "12",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "17",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.3",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "10120",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344973",
                "longitude": 21.4833,
                "accession": "ERS706403",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR25/330m_11",
                "sample-alias": "I357KR25RNA11",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706403/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706403/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706403?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706404",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "340",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2011-08-29",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR3/340m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TATAGA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.41",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "290",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "3400",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "4.1",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "12",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "17",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.3",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "10120",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344974",
                "longitude": 21.4833,
                "accession": "ERS706404",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR3/340m_11",
                "sample-alias": "I381KR03DNA11",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706404/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706404/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706404?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706405",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "340",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2011-08-29",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR3/340m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TATGTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.28",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "290",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "3400",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "4.1",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "12",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "17",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.5",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "21900",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344975",
                "longitude": 21.4833,
                "accession": "ERS706405",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR3/340m_11",
                "sample-alias": "I381KR03RNA11",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706405/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706405/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706405?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706406",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "347",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2009-12-15",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR23/347m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ACACTG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.28",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "2100",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "7930",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "3.9",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "5.1",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "55",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.5",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "21900",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344976",
                "longitude": 21.4833,
                "accession": "ERS706406",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR23/347m_09",
                "sample-alias": "I425KR23DNA09",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706406/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706406/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706406?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706407",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "347",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2009-12-15",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR23/347m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "CGCTAC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.53",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "2100",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "7930",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "3.9",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "5.1",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "55",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.7",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "17780",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344977",
                "longitude": 21.4833,
                "accession": "ERS706407",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR23/347m_09",
                "sample-alias": "I425KR23RNA09",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706407/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706407/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706407?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706408",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "372",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-01-15",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR46/372m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TATAGA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.53",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "900",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "6140",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "5.9",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "18",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "173",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.7",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "17780",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344978",
                "longitude": 21.4833,
                "accession": "ERS706408",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR46/372m_13",
                "sample-alias": "I470KR46DNA13",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706408/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706408/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706408?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706409",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "372",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-01-15",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR46/372m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TATGTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "1.6",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "900",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "6140",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "5.9",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "18",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "173",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.7",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "17010",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344979",
                "longitude": 21.4833,
                "accession": "ERS706409",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR46/372m_13",
                "sample-alias": "I470KR46RNA13",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706409/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706409/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706409?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706410",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "390",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-03-12",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR46/390m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TATGTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "1.6",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "710",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "5700",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "18",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "4.7",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "317",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.7",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "17010",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344980",
                "longitude": 21.4833,
                "accession": "ERS706410",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR46/390m_13",
                "sample-alias": "I493KR46DNA13",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706410/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706410/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706410?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706411",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "390",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-03-12",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR46/390m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TATAGA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.27",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "710",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "5700",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "18",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "4.7",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "317",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.1",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "21700",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344981",
                "longitude": 21.4833,
                "accession": "ERS706411",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR46/390m_13",
                "sample-alias": "I493KR46RNA13",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706411/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706411/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706411?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706412",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "405",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2012-10-16",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR5/405m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATAGTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.27",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "1750",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "7950",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "3",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "19",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "68",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0.03",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.1",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "21700",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344982",
                "longitude": 21.4833,
                "accession": "ERS706412",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR5/405m_12",
                "sample-alias": "I457KR05DNA12",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706412/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706412/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706412?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706413",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "405",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2012-10-16",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR5/405m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ACTCAG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.16",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "1750",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "7950",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "0",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "19",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "68",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0.03",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.1",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "26700",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344983",
                "longitude": 21.4833,
                "accession": "ERS706413",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR5/405m_12",
                "sample-alias": "I457KR05RNA12",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706413/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706413/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706413?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706414",
            "attributes": {
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "415",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2009-12-14",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR49/415m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "CTGCTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.16",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "2700",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "9940",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "0",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "19",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.1",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "26700",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 61.2333,
                "biosample": "SAMEA3344984",
                "longitude": 21.4833,
                "accession": "ERS706414",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR49/415m_09",
                "sample-alias": "I532KR49DNA09",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706414/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706414/runs?format=api"
                    }
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706414?format=api"
            }
        }
    ],
    "meta": {
        "pagination": {
            "page": 1,
            "pages": 2,
            "count": 37
        }
    }
}