HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept
{
"links": {
"first": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597/samples?format=api&page=1",
"last": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597/samples?format=api&page=2",
"next": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597/samples?format=api&page=2",
"prev": null
},
"data": [
{
"type": "samples",
"id": "ERS706390",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "296",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-01-23",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR13/296m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "CTGCTA",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "2.19",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "460",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "2920",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "27",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "10",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "35",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.9",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "8970",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344960",
"longitude": 21.4833,
"accession": "ERS706390",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR13/296m_10",
"sample-alias": "I362KR13DNA10",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706390/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706390/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706390?format=api"
}
},
{
"type": "samples",
"id": "ERS706391",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "296",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-09-03",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR13/296m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TAGTAT",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "2.19",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "460",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "2920",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "27",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "10",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "35",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.9",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "8970",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344961",
"longitude": 21.4833,
"accession": "ERS706391",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR13/296m_10",
"sample-alias": "I362KR13RNA10",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706391/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706391/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706391?format=api"
}
},
{
"type": "samples",
"id": "ERS706392",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "296",
"unit": "m"
},
{
"key": "collection date",
"value": "2012-08-21",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR13/296m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TATGTA",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "1.9",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "380",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "2540",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "28",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "38",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "35",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "8070",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344962",
"longitude": 21.4833,
"accession": "ERS706392",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR13/296m_12",
"sample-alias": "I360KR13DNA12",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706392/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706392/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706392?format=api"
}
},
{
"type": "samples",
"id": "ERS706393",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "296",
"unit": "m"
},
{
"key": "collection date",
"value": "2012-08-21",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR13/296m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TATAGA",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "1.9",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "380",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "2540",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "28",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "38",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "35",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "8070",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344963",
"longitude": 21.4833,
"accession": "ERS706393",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR13/296m_12",
"sample-alias": "I360KR13RNA12",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706393/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706393/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706393?format=api"
}
},
{
"type": "samples",
"id": "ERS706394",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "303",
"unit": "m"
},
{
"key": "collection date",
"value": "2012-08-21",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR3/303m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TAGCGC",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.42",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "350",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "3280",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "4.3",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "7.8",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "28",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "9870",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344964",
"longitude": 21.4833,
"accession": "ERS706394",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR3/303m_12",
"sample-alias": "I339KR03DNA12",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706394/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706394/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706394?format=api"
}
},
{
"type": "samples",
"id": "ERS706395",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "303",
"unit": "m"
},
{
"key": "collection date",
"value": "2012-08-21",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR3/303m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TACTCG",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.42",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "350",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "3280",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "4.3",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "7.8",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "28",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "9870",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344965",
"longitude": 21.4833,
"accession": "ERS706395",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR3/303m_12",
"sample-alias": "I339KR03RNA12",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706395/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706395/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706395?format=api"
}
},
{
"type": "samples",
"id": "ERS706396",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "323",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-21",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR20/323m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATAGTA",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "1.1",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "530",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "3790",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "13",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "11",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "52",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.7",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "11160",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344966",
"longitude": 21.4833,
"accession": "ERS706396",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR20/323m_13",
"sample-alias": "I410KR20DNA13",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706396/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706396/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706396?format=api"
}
},
{
"type": "samples",
"id": "ERS706397",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "323",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-21",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR20/323m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ACTCAG",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "1.1",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "530",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "3790",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "13",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "11",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "52",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.7",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "11160",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344967",
"longitude": 21.4833,
"accession": "ERS706397",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR20/323m_13",
"sample-alias": "I410KR20RNA13",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706397/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706397/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706397?format=api"
}
},
{
"type": "samples",
"id": "ERS706398",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "328",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-05-18",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR6/328m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TACTCG",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.37",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "1100",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "6230",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "4.1",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "0",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "77",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.9",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "18320",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344968",
"longitude": 21.4833,
"accession": "ERS706398",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR6/328m_10",
"sample-alias": "I422KR06DNA10",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706398/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706398/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706398?format=api"
}
},
{
"type": "samples",
"id": "ERS706399",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "328",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-05-18",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR6/328m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TAGCGC",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.37",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "1100",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "6230",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "4.1",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "0",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "77",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.9",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "18320",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344969",
"longitude": 21.4833,
"accession": "ERS706399",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR6/328m_10",
"sample-alias": "I422KR06RNA10",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706399/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706399/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706399?format=api"
}
},
{
"type": "samples",
"id": "ERS706400",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "330",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-20",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR6/330m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TAGCGC",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.45",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "1090",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "6160",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "4.6",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "0",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "89",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "18000",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344970",
"longitude": 21.4833,
"accession": "ERS706400",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR6/330m_13",
"sample-alias": "I422KR06DNA13",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706400/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706400/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706400?format=api"
}
},
{
"type": "samples",
"id": "ERS706401",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "330",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-20",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR6/330m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TACTCG",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "2.8",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "355",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "1940",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "33",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "13",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "29",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.9",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "6420",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344971",
"longitude": 21.4833,
"accession": "ERS706401",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR6/330m_13",
"sample-alias": "I422KR06RNA13",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706401/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706401/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706401?format=api"
}
},
{
"type": "samples",
"id": "ERS706402",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "330",
"unit": "m"
},
{
"key": "collection date",
"value": "2011-10-31",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR25/330m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ACTCAG",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "2.8",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "355",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "1940",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "33",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "13",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "29",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.9",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "6420",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344972",
"longitude": 21.4833,
"accession": "ERS706402",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR25/330m_11",
"sample-alias": "I357KR25DNA11",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706402/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706402/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706402?format=api"
}
},
{
"type": "samples",
"id": "ERS706403",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "330",
"unit": "m"
},
{
"key": "collection date",
"value": "2011-10-31",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR25/330m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TAGTAT",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.41",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "290",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "3400",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "4.1",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "12",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "17",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.3",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "10120",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344973",
"longitude": 21.4833,
"accession": "ERS706403",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR25/330m_11",
"sample-alias": "I357KR25RNA11",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706403/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706403/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706403?format=api"
}
},
{
"type": "samples",
"id": "ERS706404",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "340",
"unit": "m"
},
{
"key": "collection date",
"value": "2011-08-29",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR3/340m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TATAGA",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.41",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "290",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "3400",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "4.1",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "12",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "17",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.3",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "10120",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344974",
"longitude": 21.4833,
"accession": "ERS706404",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR3/340m_11",
"sample-alias": "I381KR03DNA11",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706404/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706404/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706404?format=api"
}
},
{
"type": "samples",
"id": "ERS706405",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "340",
"unit": "m"
},
{
"key": "collection date",
"value": "2011-08-29",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR3/340m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TATGTA",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "290",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "3400",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "4.1",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "12",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "17",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.5",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "21900",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344975",
"longitude": 21.4833,
"accession": "ERS706405",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR3/340m_11",
"sample-alias": "I381KR03RNA11",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706405/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706405/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706405?format=api"
}
},
{
"type": "samples",
"id": "ERS706406",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "347",
"unit": "m"
},
{
"key": "collection date",
"value": "2009-12-15",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR23/347m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ACACTG",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.28",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "2100",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "7930",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "3.9",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "5.1",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "55",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.5",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "21900",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344976",
"longitude": 21.4833,
"accession": "ERS706406",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR23/347m_09",
"sample-alias": "I425KR23DNA09",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706406/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706406/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706406?format=api"
}
},
{
"type": "samples",
"id": "ERS706407",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "347",
"unit": "m"
},
{
"key": "collection date",
"value": "2009-12-15",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR23/347m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "CGCTAC",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.53",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "2100",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "7930",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "3.9",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "5.1",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "55",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.7",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "17780",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344977",
"longitude": 21.4833,
"accession": "ERS706407",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR23/347m_09",
"sample-alias": "I425KR23RNA09",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706407/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706407/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706407?format=api"
}
},
{
"type": "samples",
"id": "ERS706408",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "372",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-01-15",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR46/372m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TATAGA",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.53",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "900",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "6140",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "5.9",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "18",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "173",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.7",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "17780",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344978",
"longitude": 21.4833,
"accession": "ERS706408",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR46/372m_13",
"sample-alias": "I470KR46DNA13",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706408/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706408/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706408?format=api"
}
},
{
"type": "samples",
"id": "ERS706409",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "372",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-01-15",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR46/372m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TATGTA",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "1.6",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "900",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "6140",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "5.9",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "18",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "173",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.7",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "17010",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344979",
"longitude": 21.4833,
"accession": "ERS706409",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR46/372m_13",
"sample-alias": "I470KR46RNA13",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706409/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706409/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706409?format=api"
}
},
{
"type": "samples",
"id": "ERS706410",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "390",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-03-12",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR46/390m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TATGTA",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "1.6",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "710",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "5700",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "18",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "4.7",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "317",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.7",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "17010",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344980",
"longitude": 21.4833,
"accession": "ERS706410",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR46/390m_13",
"sample-alias": "I493KR46DNA13",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706410/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706410/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706410?format=api"
}
},
{
"type": "samples",
"id": "ERS706411",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "390",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-03-12",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR46/390m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TATAGA",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.27",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "710",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "5700",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "18",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "4.7",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "317",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.1",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "21700",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344981",
"longitude": 21.4833,
"accession": "ERS706411",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR46/390m_13",
"sample-alias": "I493KR46RNA13",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706411/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706411/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706411?format=api"
}
},
{
"type": "samples",
"id": "ERS706412",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "405",
"unit": "m"
},
{
"key": "collection date",
"value": "2012-10-16",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR5/405m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATAGTA",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.27",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "1750",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "7950",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "3",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "19",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "68",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0.03",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.1",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "21700",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344982",
"longitude": 21.4833,
"accession": "ERS706412",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR5/405m_12",
"sample-alias": "I457KR05DNA12",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706412/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706412/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706412?format=api"
}
},
{
"type": "samples",
"id": "ERS706413",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "405",
"unit": "m"
},
{
"key": "collection date",
"value": "2012-10-16",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR5/405m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ACTCAG",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.16",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "1750",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "7950",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "0",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "19",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "68",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0.03",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.1",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "26700",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344983",
"longitude": 21.4833,
"accession": "ERS706413",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR5/405m_12",
"sample-alias": "I457KR05RNA12",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706413/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706413/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706413?format=api"
}
},
{
"type": "samples",
"id": "ERS706414",
"attributes": {
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "415",
"unit": "m"
},
{
"key": "collection date",
"value": "2009-12-14",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR49/415m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "CTGCTA",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.16",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "2700",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "9940",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "0",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "0",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "19",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.1",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "26700",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"biosample": "SAMEA3344984",
"longitude": 21.4833,
"accession": "ERS706414",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR49/415m_09",
"sample-alias": "I532KR49DNA09",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706414/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706414/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706414?format=api"
}
}
],
"meta": {
"pagination": {
"page": 1,
"pages": 2,
"count": 37
}
}
}