GET /metagenomics/api/v1/studies/MGYS00001357/samples?format=api
HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept

{
    "links": {
        "first": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357/samples?format=api&page=1",
        "last": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357/samples?format=api&page=48",
        "next": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357/samples?format=api&page=2",
        "prev": null
    },
    "data": [
        {
            "type": "samples",
            "id": "ERS548232",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777908",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "AGTGAGAGAAGC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548232",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Br-0_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Br-0_1_bac",
                "sample-alias": "1",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548232/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548232/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548232?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548233",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777909",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "AGTGCGATGCGT",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548233",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Rak-2_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Rak-2_1_bac",
                "sample-alias": "2",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548233/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548233/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548233?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548234",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777910",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "AGTGGATGCTCT",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548234",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Mt-0_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Mt-0_1_bac",
                "sample-alias": "3",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548234/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548234/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548234?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548235",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777911",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "AGTGTCACGGTG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548235",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Fab-2_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Fab-2_1_bac",
                "sample-alias": "4",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548235/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548235/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548235?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548236",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777912",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "AGTGTTCGATCG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548236",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Dem-4_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Dem-4_1_bac",
                "sample-alias": "5",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548236/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548236/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548236?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548237",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777913",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "AGTTAGTGCGTC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548237",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Vastervik_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Vastervik_1_bac",
                "sample-alias": "6",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548237/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548237/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548237?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548238",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777914",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "AGTTCAGACGCT",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548238",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Na-1_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Na-1_1_bac",
                "sample-alias": "7",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548238/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548238/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548238?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548239",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777915",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "AGTTCTACGTCA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548239",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Tsu-1_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Tsu-1_1_bac",
                "sample-alias": "8",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548239/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548239/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548239?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548240",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777916",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATAATCTCGTCG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548240",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Sorbo_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Sorbo_1_bac",
                "sample-alias": "9",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548240/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548240/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548240?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548241",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777917",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATACACGTGGCG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548241",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Sq-1_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Sq-1_1_bac",
                "sample-alias": "10",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548241/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548241/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548241?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548242",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777918",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATACAGAGCTCC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548242",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "St-0_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "St-0_1_bac",
                "sample-alias": "11",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548242/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548242/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548242?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548243",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777919",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATACGTCTTCGA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548243",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Kulturen-1_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Kulturen-1_1_bac",
                "sample-alias": "12",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548243/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548243/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548243?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548244",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777920",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATACTATTGCGC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548244",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Gr-1_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Gr-1_1_bac",
                "sample-alias": "13",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548244/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548244/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548244?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548245",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777921",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATACTCACTCAG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548245",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Ba3-3_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Ba3-3_1_bac",
                "sample-alias": "14",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548245/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548245/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548245?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548246",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777922",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATAGCTCCATAC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548246",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Cen-0_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Cen-0_1_bac",
                "sample-alias": "15",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548246/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548246/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548246?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548247",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777923",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATAGGCGATCTC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548247",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Kavlinge-1_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Kavlinge-1_1_bac",
                "sample-alias": "16",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548247/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548247/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548247?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548248",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777924",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATATCGCTACTG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548248",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Pna-10_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Pna-10_1_bac",
                "sample-alias": "17",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548248/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548248/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548248?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548249",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777925",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATATGCCAGTGC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548249",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Sanna-2_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Sanna-2_1_bac",
                "sample-alias": "18",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548249/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548249/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548249?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548250",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777926",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATCACGTAGCGG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548250",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Tottarp-2_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Tottarp-2_1_bac",
                "sample-alias": "19",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548250/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548250/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548250?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548251",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777927",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATCACTAGTCAC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548251",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Mt-0_2",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Mt-0_2_bac",
                "sample-alias": "20",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548251/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548251/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548251?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548252",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777928",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATCAGGCGTGTG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548252",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Tamm-2_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Tamm-2_1_bac",
                "sample-alias": "21",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548252/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548252/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548252?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548253",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777929",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATCCGATCACAG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548253",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Ts-1_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Ts-1_1_bac",
                "sample-alias": "22",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548253/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548253/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548253?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548254",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777930",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATCCTCAGTAGT",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548254",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Hsm_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Hsm_1_bac",
                "sample-alias": "23",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548254/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548254/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548254?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548255",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777931",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATCGATCTGTGG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548255",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Ost-0_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Ost-0_1_bac",
                "sample-alias": "24",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548255/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548255/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548255?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS548256",
            "attributes": {
                "latitude": 42.0831,
                "longitude": 86.351,
                "biosample": "SAMEA2777932",
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Arabidopsis leaves",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2009-03-27",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V5-V7",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ATCGCGGACGAT",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "454",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Arabidopsis thaliana",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "3702",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS plant associated (ERC000020)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Benton Harbor, Michigan",
                        "unit": null
                    },
                    {
                        "key": "host age",
                        "value": "179",
                        "unit": "days"
                    },
                    {
                        "key": "plant-associated environmental package",
                        "value": "plant-associated",
                        "unit": null
                    }
                ],
                "accession": "ERS548256",
                "analysis-completed": "2017-01-05",
                "collection-date": null,
                "geo-loc-name": "USA",
                "sample-desc": "Or-1_1",
                "environment-biome": "113",
                "environment-feature": "field",
                "environment-material": "soil",
                "sample-name": "Or-1_1_bac",
                "sample-alias": "25",
                "host-tax-id": 3702,
                "species": "Arabidopsis thaliana",
                "last-update": "2017-01-05T10:11:38"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Plants:Phylloplane"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548256/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001357",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548256/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548256?format=api"
            }
        }
    ],
    "meta": {
        "pagination": {
            "page": 1,
            "pages": 48,
            "count": 1196
        }
    }
}