HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept
{
"links": {
"first": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357/samples?format=api&page=1",
"last": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357/samples?format=api&page=48",
"next": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357/samples?format=api&page=2",
"prev": null
},
"data": [
{
"type": "samples",
"id": "ERS548232",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777908",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "AGTGAGAGAAGC",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548232",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Br-0_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Br-0_1_bac",
"sample-alias": "1",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548232/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548232/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548232?format=api"
}
},
{
"type": "samples",
"id": "ERS548233",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777909",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "AGTGCGATGCGT",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548233",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Rak-2_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Rak-2_1_bac",
"sample-alias": "2",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548233/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548233/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548233?format=api"
}
},
{
"type": "samples",
"id": "ERS548234",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777910",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "AGTGGATGCTCT",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548234",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Mt-0_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Mt-0_1_bac",
"sample-alias": "3",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548234/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548234/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548234?format=api"
}
},
{
"type": "samples",
"id": "ERS548235",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777911",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "AGTGTCACGGTG",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548235",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Fab-2_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Fab-2_1_bac",
"sample-alias": "4",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548235/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548235/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548235?format=api"
}
},
{
"type": "samples",
"id": "ERS548236",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777912",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "AGTGTTCGATCG",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548236",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Dem-4_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Dem-4_1_bac",
"sample-alias": "5",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548236/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548236/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548236?format=api"
}
},
{
"type": "samples",
"id": "ERS548237",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777913",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "AGTTAGTGCGTC",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548237",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Vastervik_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Vastervik_1_bac",
"sample-alias": "6",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548237/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548237/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548237?format=api"
}
},
{
"type": "samples",
"id": "ERS548238",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777914",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "AGTTCAGACGCT",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548238",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Na-1_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Na-1_1_bac",
"sample-alias": "7",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548238/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548238/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548238?format=api"
}
},
{
"type": "samples",
"id": "ERS548239",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777915",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "AGTTCTACGTCA",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548239",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Tsu-1_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Tsu-1_1_bac",
"sample-alias": "8",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548239/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548239/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548239?format=api"
}
},
{
"type": "samples",
"id": "ERS548240",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777916",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATAATCTCGTCG",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548240",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Sorbo_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Sorbo_1_bac",
"sample-alias": "9",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548240/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548240/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548240?format=api"
}
},
{
"type": "samples",
"id": "ERS548241",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777917",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATACACGTGGCG",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548241",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Sq-1_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Sq-1_1_bac",
"sample-alias": "10",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548241/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548241/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548241?format=api"
}
},
{
"type": "samples",
"id": "ERS548242",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777918",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATACAGAGCTCC",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548242",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "St-0_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "St-0_1_bac",
"sample-alias": "11",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548242/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548242/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548242?format=api"
}
},
{
"type": "samples",
"id": "ERS548243",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777919",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATACGTCTTCGA",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548243",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Kulturen-1_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Kulturen-1_1_bac",
"sample-alias": "12",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548243/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548243/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548243?format=api"
}
},
{
"type": "samples",
"id": "ERS548244",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777920",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATACTATTGCGC",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548244",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Gr-1_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Gr-1_1_bac",
"sample-alias": "13",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548244/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548244/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548244?format=api"
}
},
{
"type": "samples",
"id": "ERS548245",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777921",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATACTCACTCAG",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548245",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Ba3-3_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Ba3-3_1_bac",
"sample-alias": "14",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548245/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548245/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548245?format=api"
}
},
{
"type": "samples",
"id": "ERS548246",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777922",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATAGCTCCATAC",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548246",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Cen-0_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Cen-0_1_bac",
"sample-alias": "15",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548246/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548246/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548246?format=api"
}
},
{
"type": "samples",
"id": "ERS548247",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777923",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATAGGCGATCTC",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548247",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Kavlinge-1_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Kavlinge-1_1_bac",
"sample-alias": "16",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548247/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548247/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548247?format=api"
}
},
{
"type": "samples",
"id": "ERS548248",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777924",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATATCGCTACTG",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548248",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Pna-10_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Pna-10_1_bac",
"sample-alias": "17",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548248/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548248/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548248?format=api"
}
},
{
"type": "samples",
"id": "ERS548249",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777925",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATATGCCAGTGC",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548249",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Sanna-2_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Sanna-2_1_bac",
"sample-alias": "18",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548249/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548249/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548249?format=api"
}
},
{
"type": "samples",
"id": "ERS548250",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777926",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATCACGTAGCGG",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548250",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Tottarp-2_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Tottarp-2_1_bac",
"sample-alias": "19",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548250/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548250/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548250?format=api"
}
},
{
"type": "samples",
"id": "ERS548251",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777927",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATCACTAGTCAC",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548251",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Mt-0_2",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Mt-0_2_bac",
"sample-alias": "20",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548251/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548251/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548251?format=api"
}
},
{
"type": "samples",
"id": "ERS548252",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777928",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATCAGGCGTGTG",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548252",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Tamm-2_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Tamm-2_1_bac",
"sample-alias": "21",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548252/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548252/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548252?format=api"
}
},
{
"type": "samples",
"id": "ERS548253",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777929",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATCCGATCACAG",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548253",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Ts-1_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Ts-1_1_bac",
"sample-alias": "22",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548253/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548253/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548253?format=api"
}
},
{
"type": "samples",
"id": "ERS548254",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777930",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATCCTCAGTAGT",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548254",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Hsm_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Hsm_1_bac",
"sample-alias": "23",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548254/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548254/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548254?format=api"
}
},
{
"type": "samples",
"id": "ERS548255",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777931",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATCGATCTGTGG",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548255",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Ost-0_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Ost-0_1_bac",
"sample-alias": "24",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548255/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548255/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548255?format=api"
}
},
{
"type": "samples",
"id": "ERS548256",
"attributes": {
"latitude": 42.0831,
"longitude": 86.351,
"biosample": "SAMEA2777932",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Arabidopsis leaves",
"unit": null
},
{
"key": "collection date",
"value": "2009-03-27",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V5-V7",
"unit": null
},
{
"key": "pcr primers",
"value": "AACMGGATTAGATACCCKG, ATACGTCATCCCCACCTTCC",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ATCGCGGACGAT",
"unit": null
},
{
"key": "adapters",
"value": "CCTATCCCCTGTGTGCCTTGGCAGTCTCAG; CCATCTCATCCCTGCGTGTCTCCGACTCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "454",
"unit": null
},
{
"key": "host common name",
"value": "Arabidopsis thaliana",
"unit": null
},
{
"key": "host taxid",
"value": "3702",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "3702",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS plant associated (ERC000020)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Benton Harbor, Michigan",
"unit": null
},
{
"key": "host age",
"value": "179",
"unit": "days"
},
{
"key": "plant-associated environmental package",
"value": "plant-associated",
"unit": null
}
],
"accession": "ERS548256",
"analysis-completed": "2017-01-05",
"collection-date": null,
"geo-loc-name": "USA",
"sample-desc": "Or-1_1",
"environment-biome": "113",
"environment-feature": "field",
"environment-material": "soil",
"sample-name": "Or-1_1_bac",
"sample-alias": "25",
"host-tax-id": 3702,
"species": "Arabidopsis thaliana",
"last-update": "2017-01-05T10:11:38"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Plants:Phylloplane"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Plants:Phylloplane?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548256/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001357",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001357?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548256/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS548256?format=api"
}
}
],
"meta": {
"pagination": {
"page": 1,
"pages": 48,
"count": 1196
}
}
}