GET /metagenomics/api/v1/studies/MGYS00000307/samples?format=api
HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept

{
    "links": {
        "first": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307/samples?format=api&page=1",
        "last": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307/samples?format=api&page=2",
        "next": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307/samples?format=api&page=2",
        "prev": null
    },
    "data": [
        {
            "type": "samples",
            "id": "ERS161373",
            "attributes": {
                "biosample": "SAMEA2128220",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "3.01",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C1.v",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161373",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 1",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 1",
                "sample-alias": " C1.v",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161373/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161373/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161373?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161374",
            "attributes": {
                "biosample": "SAMEA2128249",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "3.01",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C1.b",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161374",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 1 (amplicon)",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 1 (amplicon)",
                "sample-alias": " C1.b",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161374/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161374/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161374?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161375",
            "attributes": {
                "biosample": "SAMEA2128222",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "5.92",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C2.v",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161375",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 2",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 2",
                "sample-alias": " C2.v",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161375/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161375/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161375?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161376",
            "attributes": {
                "biosample": "SAMEA2128205",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "5.92",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C2.b",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161376",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 2 (amplicon)",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 2 (amplicon)",
                "sample-alias": " C2.b",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161376/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161376/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161376?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161377",
            "attributes": {
                "biosample": "SAMEA2128239",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "22.95",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C3.v",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161377",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 3",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 3",
                "sample-alias": " C3.v",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161377/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161377/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161377?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161378",
            "attributes": {
                "biosample": "SAMEA2128208",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "22.95",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C3.b",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161378",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 3 (amplicon)",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 3 (amplicon)",
                "sample-alias": " C3.b",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161378/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161378/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161378?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161379",
            "attributes": {
                "biosample": "SAMEA2128250",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "19.92",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C4.v",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161379",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 4",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 4",
                "sample-alias": " C4.v",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161379/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161379/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161379?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161380",
            "attributes": {
                "biosample": "SAMEA2128211",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "19.92",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C4.b",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161380",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 4 (amplicon)",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 4 (amplicon)",
                "sample-alias": " C4.b",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161380/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161380/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161380?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161381",
            "attributes": {
                "biosample": "SAMEA2128243",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "23.55",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C5.v",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161381",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 5",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 5",
                "sample-alias": " C5.v",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161381/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161381/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161381?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161382",
            "attributes": {
                "biosample": "SAMEA2128209",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "23.55",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C5.b",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161382",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 5 (amplicon)",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 5 (amplicon)",
                "sample-alias": " C5.b",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161382/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161382/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161382?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161383",
            "attributes": {
                "biosample": "SAMEA2128251",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "31.47",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C6.v",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161383",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 6",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 6",
                "sample-alias": " C6.v",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161383/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161383/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161383?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161384",
            "attributes": {
                "biosample": "SAMEA2128219",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "31.47",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C6.b",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161384",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 6 (amplicon)",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 6 (amplicon)",
                "sample-alias": " C6.b",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161384/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161384/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161384?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161385",
            "attributes": {
                "biosample": "SAMEA2128245",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "10.29",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C7.v",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161385",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 7",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 7",
                "sample-alias": " C7.v",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161385/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161385/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161385?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161386",
            "attributes": {
                "biosample": "SAMEA2128223",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "10.29",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C7.b",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161386",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 7 (amplicon)",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 7 (amplicon)",
                "sample-alias": " C7.b",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161386/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161386/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161386?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161387",
            "attributes": {
                "biosample": "SAMEA2128204",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "24.75",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C8.v",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161387",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 8",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 8",
                "sample-alias": " C8.v",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161387/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161387/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161387?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161388",
            "attributes": {
                "biosample": "SAMEA2128244",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "24.75",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C8.b",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161388",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 8 (amplicon)",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 8 (amplicon)",
                "sample-alias": " C8.b",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161388/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161388/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161388?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161389",
            "attributes": {
                "biosample": "SAMEA2128218",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "5.77",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C9.v",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161389",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 9",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 9",
                "sample-alias": " C9.v",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161389/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161389/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161389?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161390",
            "attributes": {
                "biosample": "SAMEA2128215",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "5.77",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C9.b",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161390",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 9 (amplicon)",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 9 (amplicon)",
                "sample-alias": " C9.b",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161390/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161390/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161390?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161391",
            "attributes": {
                "biosample": "SAMEA2128217",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "25.38",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C10.v",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161391",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 10",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 10",
                "sample-alias": " C10.v",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161391/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161391/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161391?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161392",
            "attributes": {
                "biosample": "SAMEA2128246",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "25.38",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "C10.b",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161392",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from Crohn's patient 10 (amplicon)",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from Crohn's patient 10 (amplicon)",
                "sample-alias": " C10.b",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161392/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161392/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161392?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161393",
            "attributes": {
                "biosample": "SAMEA2128221",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "°C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "Intestinal tissue sample from Crohn's patient 11",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "< 0.2",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "IC1.v",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161393",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Intestinal tissue sample from Crohn's patient 11",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "Intestinal tissue sample from Crohn's patient 11",
                "sample-name": "Intestinal tissue sample from Crohn's patient 11",
                "sample-alias": " IC1.v",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161393/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161393/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161393?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161394",
            "attributes": {
                "biosample": "SAMEA2128242",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "&deg;C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "July 2011",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "Intestinal tissue sample from Crohn's patient 11",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "< 0.2",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": "id: DOID:8778 Crohn's disease",
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "Crohns disease",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "IC1.b",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161394",
                "analysis-completed": "2013-07-25",
                "collection-date": "2011-07-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Intestinal tissue sample from Crohn's patient 11 (amplicon)",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "Intestinal tissue sample from Crohn's patient 11",
                "sample-name": "Intestinal tissue sample from Crohn's patient 11 (amplicon)",
                "sample-alias": " IC1.b",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161394/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161394/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161394?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161395",
            "attributes": {
                "biosample": "SAMEA2128214",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "&deg;C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "March 2012",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "14.93",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "none",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "V1.v",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161395",
                "analysis-completed": "2013-07-25",
                "collection-date": "2012-03-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from control volunteer 1",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from control volunteer 1",
                "sample-alias": " V1.v",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161395/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161395/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161395?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161396",
            "attributes": {
                "biosample": "SAMEA2128224",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "&deg;C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "March 2012",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "14.93",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "none",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "V1.b",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161396",
                "analysis-completed": "2013-07-25",
                "collection-date": "2012-03-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from control volunteer 1 (amplicon)",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from control volunteer 1 (amplicon)",
                "sample-alias": " V1.b",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161396/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161396/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161396?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS161397",
            "attributes": {
                "biosample": "SAMEA2128248",
                "longitude": -0.3744,
                "latitude": 39.4767,
                "sample-metadata": [
                    {
                        "key": "sample storage temperature",
                        "value": "-70",
                        "unit": "&deg;C"
                    },
                    {
                        "key": "geographic location (longitude)",
                        "value": "-0.374444444",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Spain; Valencia",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "March 2012",
                        "unit": null
                    },
                    {
                        "key": "environment (biome)",
                        "value": "terrestrial biome ENVO:00000446",
                        "unit": null
                    },
                    {
                        "key": "environment (feature)",
                        "value": "human-associated habitat",
                        "unit": null
                    },
                    {
                        "key": "environment (material)",
                        "value": "feces",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "10.57",
                        "unit": "g"
                    },
                    {
                        "key": "pcr primers",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "disease status",
                        "value": null,
                        "unit": null
                    },
                    {
                        "key": "host common name",
                        "value": "Homo sapiens",
                        "unit": null
                    },
                    {
                        "key": "host taxid",
                        "value": "9606",
                        "unit": null
                    },
                    {
                        "key": "phenotype",
                        "value": "none",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "39.47666667",
                        "unit": null
                    },
                    {
                        "key": "alt id - submitted sample id",
                        "value": "V2.v",
                        "unit": null
                    },
                    {
                        "key": "body habitat",
                        "value": "gut",
                        "unit": null
                    },
                    {
                        "key": "storage conditions (fresh/frozen/other)",
                        "value": "Frozen",
                        "unit": null
                    },
                    {
                        "key": "GOLD sample classification",
                        "value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "408170",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    }
                ],
                "accession": "ERS161397",
                "analysis-completed": "2013-07-25",
                "collection-date": "2012-03-01",
                "geo-loc-name": "Spain; Valencia",
                "sample-desc": "Fecal sample from control volunteer 2",
                "environment-biome": "terrestrial biome ENVO:00000446",
                "environment-feature": "human-associated habitat",
                "environment-material": "feces",
                "sample-name": "Fecal sample from control volunteer 2",
                "sample-alias": " V2.v",
                "host-tax-id": 9606,
                "species": "Homo sapiens",
                "last-update": "2015-08-13T15:30:55"
            },
            "relationships": {
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161397/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000307",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
                            }
                        }
                    ]
                },
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
                    }
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161397/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161397?format=api"
            }
        }
    ],
    "meta": {
        "pagination": {
            "page": 1,
            "pages": 2,
            "count": 38
        }
    }
}