HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept
{
"links": {
"first": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307/samples?format=api&page=1",
"last": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307/samples?format=api&page=2",
"next": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307/samples?format=api&page=2",
"prev": null
},
"data": [
{
"type": "samples",
"id": "ERS161373",
"attributes": {
"biosample": "SAMEA2128220",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "3.01",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C1.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161373",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 1",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 1",
"sample-alias": " C1.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161373/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161373/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161373?format=api"
}
},
{
"type": "samples",
"id": "ERS161374",
"attributes": {
"biosample": "SAMEA2128249",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "3.01",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C1.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161374",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 1 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 1 (amplicon)",
"sample-alias": " C1.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161374/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161374/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161374?format=api"
}
},
{
"type": "samples",
"id": "ERS161375",
"attributes": {
"biosample": "SAMEA2128222",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "5.92",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C2.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161375",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 2",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 2",
"sample-alias": " C2.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161375/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161375/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161375?format=api"
}
},
{
"type": "samples",
"id": "ERS161376",
"attributes": {
"biosample": "SAMEA2128205",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "5.92",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C2.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161376",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 2 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 2 (amplicon)",
"sample-alias": " C2.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161376/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161376/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161376?format=api"
}
},
{
"type": "samples",
"id": "ERS161377",
"attributes": {
"biosample": "SAMEA2128239",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "22.95",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C3.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161377",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 3",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 3",
"sample-alias": " C3.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161377/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161377/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161377?format=api"
}
},
{
"type": "samples",
"id": "ERS161378",
"attributes": {
"biosample": "SAMEA2128208",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "22.95",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C3.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161378",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 3 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 3 (amplicon)",
"sample-alias": " C3.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161378/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161378/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161378?format=api"
}
},
{
"type": "samples",
"id": "ERS161379",
"attributes": {
"biosample": "SAMEA2128250",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "19.92",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C4.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161379",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 4",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 4",
"sample-alias": " C4.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161379/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161379/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161379?format=api"
}
},
{
"type": "samples",
"id": "ERS161380",
"attributes": {
"biosample": "SAMEA2128211",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "19.92",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C4.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161380",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 4 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 4 (amplicon)",
"sample-alias": " C4.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161380/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161380/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161380?format=api"
}
},
{
"type": "samples",
"id": "ERS161381",
"attributes": {
"biosample": "SAMEA2128243",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "23.55",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C5.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161381",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 5",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 5",
"sample-alias": " C5.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161381/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161381/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161381?format=api"
}
},
{
"type": "samples",
"id": "ERS161382",
"attributes": {
"biosample": "SAMEA2128209",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "23.55",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C5.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161382",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 5 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 5 (amplicon)",
"sample-alias": " C5.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161382/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161382/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161382?format=api"
}
},
{
"type": "samples",
"id": "ERS161383",
"attributes": {
"biosample": "SAMEA2128251",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "31.47",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C6.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161383",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 6",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 6",
"sample-alias": " C6.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161383/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161383/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161383?format=api"
}
},
{
"type": "samples",
"id": "ERS161384",
"attributes": {
"biosample": "SAMEA2128219",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "31.47",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C6.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161384",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 6 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 6 (amplicon)",
"sample-alias": " C6.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161384/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161384/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161384?format=api"
}
},
{
"type": "samples",
"id": "ERS161385",
"attributes": {
"biosample": "SAMEA2128245",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "10.29",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C7.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161385",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 7",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 7",
"sample-alias": " C7.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161385/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161385/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161385?format=api"
}
},
{
"type": "samples",
"id": "ERS161386",
"attributes": {
"biosample": "SAMEA2128223",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "10.29",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C7.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161386",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 7 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 7 (amplicon)",
"sample-alias": " C7.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161386/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161386/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161386?format=api"
}
},
{
"type": "samples",
"id": "ERS161387",
"attributes": {
"biosample": "SAMEA2128204",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "24.75",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C8.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161387",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 8",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 8",
"sample-alias": " C8.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161387/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161387/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161387?format=api"
}
},
{
"type": "samples",
"id": "ERS161388",
"attributes": {
"biosample": "SAMEA2128244",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "24.75",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C8.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161388",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 8 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 8 (amplicon)",
"sample-alias": " C8.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161388/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161388/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161388?format=api"
}
},
{
"type": "samples",
"id": "ERS161389",
"attributes": {
"biosample": "SAMEA2128218",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "5.77",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C9.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161389",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 9",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 9",
"sample-alias": " C9.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161389/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161389/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161389?format=api"
}
},
{
"type": "samples",
"id": "ERS161390",
"attributes": {
"biosample": "SAMEA2128215",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "5.77",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C9.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161390",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 9 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 9 (amplicon)",
"sample-alias": " C9.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161390/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161390/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161390?format=api"
}
},
{
"type": "samples",
"id": "ERS161391",
"attributes": {
"biosample": "SAMEA2128217",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "25.38",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C10.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161391",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 10",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 10",
"sample-alias": " C10.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161391/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161391/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161391?format=api"
}
},
{
"type": "samples",
"id": "ERS161392",
"attributes": {
"biosample": "SAMEA2128246",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "25.38",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C10.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161392",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 10 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 10 (amplicon)",
"sample-alias": " C10.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161392/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161392/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161392?format=api"
}
},
{
"type": "samples",
"id": "ERS161393",
"attributes": {
"biosample": "SAMEA2128221",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "Intestinal tissue sample from Crohn's patient 11",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "< 0.2",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "IC1.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161393",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Intestinal tissue sample from Crohn's patient 11",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "Intestinal tissue sample from Crohn's patient 11",
"sample-name": "Intestinal tissue sample from Crohn's patient 11",
"sample-alias": " IC1.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161393/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161393/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161393?format=api"
}
},
{
"type": "samples",
"id": "ERS161394",
"attributes": {
"biosample": "SAMEA2128242",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "Intestinal tissue sample from Crohn's patient 11",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "< 0.2",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "IC1.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161394",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Intestinal tissue sample from Crohn's patient 11 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "Intestinal tissue sample from Crohn's patient 11",
"sample-name": "Intestinal tissue sample from Crohn's patient 11 (amplicon)",
"sample-alias": " IC1.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161394/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161394/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161394?format=api"
}
},
{
"type": "samples",
"id": "ERS161395",
"attributes": {
"biosample": "SAMEA2128214",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "14.93",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V1.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161395",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 1",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 1",
"sample-alias": " V1.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161395/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161395/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161395?format=api"
}
},
{
"type": "samples",
"id": "ERS161396",
"attributes": {
"biosample": "SAMEA2128224",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "14.93",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V1.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161396",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 1 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 1 (amplicon)",
"sample-alias": " V1.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161396/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161396/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161396?format=api"
}
},
{
"type": "samples",
"id": "ERS161397",
"attributes": {
"biosample": "SAMEA2128248",
"longitude": -0.3744,
"latitude": 39.4767,
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "10.57",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V2.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161397",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 2",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 2",
"sample-alias": " V2.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161397/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161397/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161397?format=api"
}
}
],
"meta": {
"pagination": {
"page": 1,
"pages": 2,
"count": 38
}
}
}