GET /metagenomics/api/v1/samples/ERS756901?format=api
HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept

{
    "data": {
        "type": "samples",
        "id": "ERS756901",
        "attributes": {
            "longitude": 4.9048,
            "latitude": 53.1568,
            "biosample": "SAMEA3462003",
            "sample-metadata": [
                {
                    "key": "sample storage temperature",
                    "value": "-80",
                    "unit": "\\'||chr(38)||\\'deg;C"
                },
                {
                    "key": "temperature",
                    "value": "17.19172972",
                    "unit": "\\'||chr(38)||\\'deg;C"
                },
                {
                    "key": "investigation type",
                    "value": "mimarks-survey",
                    "unit": null
                },
                {
                    "key": "project name",
                    "value": "PRJEB9624",
                    "unit": null
                },
                {
                    "key": "collection date",
                    "value": "2012-06-29",
                    "unit": null
                },
                {
                    "key": "sample collection device or method",
                    "value": "syringe",
                    "unit": null
                },
                {
                    "key": "amount or size of sample collected",
                    "value": "0.002",
                    "unit": "L"
                },
                {
                    "key": "target gene",
                    "value": "16s rRNA",
                    "unit": null
                },
                {
                    "key": "target subfragment",
                    "value": "V1-V2",
                    "unit": null
                },
                {
                    "key": "pcr primers",
                    "value": "27f-338r,27F: TCAGAGTTTGATCMTGGCTCAG + 338r: CATGCTGCCTCCCGTAGGAGT",
                    "unit": null
                },
                {
                    "key": "multiplex identifiers",
                    "value": "f: GCTTGCAA; r: AAGGCCTT",
                    "unit": null
                },
                {
                    "key": "pcr conditions",
                    "value": "initial denaturation:98degC_30s; denaturation:98degC_9s;annealing:55degC_1min; elongation:72degC_90s; final elongation:72degC_10min; 30 cycles",
                    "unit": null
                },
                {
                    "key": "sequencing method",
                    "value": "Sequencing by synthesis, Illumina paired-end",
                    "unit": null
                },
                {
                    "key": "chemical administration",
                    "value": "None",
                    "unit": null
                },
                {
                    "key": "host common name",
                    "value": "Pacific oyster",
                    "unit": null
                },
                {
                    "key": "host taxid",
                    "value": "29159",
                    "unit": null
                },
                {
                    "key": "perturbation",
                    "value": "not antibiotic treated",
                    "unit": null
                },
                {
                    "key": "NCBI sample classification",
                    "value": "29159",
                    "unit": null
                },
                {
                    "key": "instrument model",
                    "value": "Illumina MiSeq",
                    "unit": null
                },
                {
                    "key": "ENA checklist",
                    "value": "GSC MIxS host associated (ERC000013)",
                    "unit": null
                },
                {
                    "key": "geographic location (region and locality)",
                    "value": "Netherlands, Texel, de Cocksdorp",
                    "unit": null
                },
                {
                    "key": "host body habitat",
                    "value": "hemolymph",
                    "unit": null
                },
                {
                    "key": "host body product",
                    "value": "NA",
                    "unit": null
                },
                {
                    "key": "host body site",
                    "value": "adductor muscle",
                    "unit": null
                },
                {
                    "key": "host life stage",
                    "value": "adult",
                    "unit": null
                },
                {
                    "key": "sample volume or weight for DNA extraction",
                    "value": "0.2",
                    "unit": "mL"
                },
                {
                    "key": "host-associated environmental package",
                    "value": "host-associated",
                    "unit": null
                }
            ],
            "accession": "ERS756901",
            "analysis-completed": "2017-03-21",
            "collection-date": null,
            "geo-loc-name": "North Sea",
            "sample-desc": "Pacific oyster (Crassostrea gigas) hemolymph microbiota; collected on Texel, 2012-06-29; sample taken after field deployment; not antibiotic treated; oyster from Sylt, translocated from Sylt (D) to Texel (NL)",
            "environment-biome": "aquatic, marine, benthic, coastal",
            "environment-feature": "organic",
            "environment-material": "organic material, bodily fluid",
            "sample-name": "Pacific oyster hemolymph microbiota from Texel, translocated from Sylt",
            "sample-alias": "Cg_115_Hem_Tx_SyC_20120629",
            "host-tax-id": 29159,
            "species": "Crassostrea gigas",
            "last-update": "2017-03-21T11:44:24"
        },
        "relationships": {
            "biome": {
                "data": {
                    "type": "biomes",
                    "id": "root:Host-associated:Mollusca:Digestive system"
                },
                "links": {
                    "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Mollusca:Digestive%20system?format=api"
                }
            },
            "studies": {
                "links": {
                    "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756901/studies?format=api"
                },
                "data": [
                    {
                        "type": "studies",
                        "id": "MGYS00001607",
                        "links": {
                            "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001607?format=api"
                        }
                    }
                ]
            },
            "runs": {
                "links": {
                    "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756901/runs?format=api"
                }
            }
        },
        "links": {
            "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS756901?format=api"
        }
    }
}