HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept
{
"links": {
"first": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine/samples?format=api&page=1",
"last": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine/samples?format=api&page=2",
"next": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine/samples?format=api&page=2",
"prev": null
},
"data": [
{
"type": "samples",
"id": "SRS1541698",
"attributes": {
"biosample": "SAMN05361882",
"longitude": null,
"sample-metadata": [
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Hangzhou",
"unit": null
},
{
"key": "collection date",
"value": "2015-09-25",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "last update date",
"value": "2016-07-08",
"unit": null
}
],
"latitude": null,
"accession": "SRS1541698",
"analysis-completed": "2019-04-06",
"collection-date": "2015-09-25",
"geo-loc-name": "China:Hangzhou",
"sample-desc": "This sample has been submitted by pda|hetrue on 2016-07-08; Escherichia coli",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "25922 Delta acrAB-TGC8",
"sample-alias": "25922 Delta acrAB-TGC8",
"host-tax-id": null,
"species": null,
"last-update": "2019-04-06T13:02:27"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541698/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00004440",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00004440?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541698/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541698?format=api"
}
},
{
"type": "samples",
"id": "SRS1554806",
"attributes": {
"biosample": "SAMN05361883",
"longitude": null,
"sample-metadata": [
{
"key": "geographic location (country and/or sea,region)",
"value": "Chile",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "last update date",
"value": "2016-07-13",
"unit": null
}
],
"latitude": null,
"accession": "SRS1554806",
"analysis-completed": "2019-04-06",
"collection-date": null,
"geo-loc-name": "Chile",
"sample-desc": "Mesocarp sample from Prunus persica cv Magique",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "MG",
"sample-alias": "MG",
"host-tax-id": null,
"species": null,
"last-update": "2019-04-06T13:02:27"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1554806/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00004440",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00004440?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1554806/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1554806?format=api"
}
},
{
"type": "samples",
"id": "SRS1554807",
"attributes": {
"biosample": "SAMN05361884",
"longitude": null,
"sample-metadata": [
{
"key": "geographic location (country and/or sea,region)",
"value": "Chile",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "last update date",
"value": "2016-07-12",
"unit": null
}
],
"latitude": null,
"accession": "SRS1554807",
"analysis-completed": "2019-04-06",
"collection-date": null,
"geo-loc-name": "Chile",
"sample-desc": "Transcriptome analysis of peach cultivars with different harvest date under cold storage",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "RG",
"sample-alias": "RG",
"host-tax-id": null,
"species": null,
"last-update": "2019-04-06T13:02:27"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1554807/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00004440",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00004440?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1554807/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1554807?format=api"
}
},
{
"type": "samples",
"id": "SRS1541678",
"attributes": {
"biosample": "SAMN05361881",
"longitude": null,
"sample-metadata": [
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "last update date",
"value": "2016-07-08",
"unit": null
}
],
"latitude": null,
"accession": "SRS1541678",
"analysis-completed": "2019-04-06",
"collection-date": null,
"geo-loc-name": null,
"sample-desc": "fresh bovine oocyte",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "fresh bovine oocyte",
"sample-alias": "fresh bovine oocyte",
"host-tax-id": null,
"species": null,
"last-update": "2019-04-06T13:02:26"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541678/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00004440",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00004440?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541678/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541678?format=api"
}
},
{
"type": "samples",
"id": "SRS1541679",
"attributes": {
"biosample": "SAMN05361885",
"longitude": null,
"sample-metadata": [
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "last update date",
"value": "2016-07-07",
"unit": null
}
],
"latitude": null,
"accession": "SRS1541679",
"analysis-completed": "2019-04-06",
"collection-date": null,
"geo-loc-name": null,
"sample-desc": "transcriptome of fresh bovine oocyte-2",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "fresh bovine oocyte-2",
"sample-alias": "fresh bovine oocyte-2",
"host-tax-id": null,
"species": null,
"last-update": "2019-04-06T13:02:26"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541679/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00004440",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00004440?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541679/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541679?format=api"
}
},
{
"type": "samples",
"id": "SRS1541681",
"attributes": {
"biosample": "SAMN05361886",
"longitude": 17.9284,
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "17.92838",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Sweden",
"unit": null
},
{
"key": "collection date",
"value": "2016-01-01",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "59.43865",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "last update date",
"value": "2016-09-08",
"unit": null
}
],
"latitude": 59.4387,
"accession": "SRS1541681",
"analysis-completed": "2019-04-06",
"collection-date": "2016-01-01",
"geo-loc-name": "Sweden",
"sample-desc": "This sample has been submitted by pda|bjhall on 2016-09-08; Sapporo virus",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "S6",
"sample-alias": "S6",
"host-tax-id": null,
"species": null,
"last-update": "2019-04-06T13:02:26"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541681/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00004440",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00004440?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541681/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541681?format=api"
}
},
{
"type": "samples",
"id": "ERS710570",
"attributes": {
"biosample": "SAMEA3356741",
"longitude": 25.9815,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Geomikro",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "2410",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-13",
"unit": null
},
{
"key": "source material identifiers",
"value": "R-2247",
"unit": null
},
{
"key": "sample collection device or method",
"value": "free flow",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V3",
"unit": null
},
{
"key": "pcr primers",
"value": "8F/P2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "CATGCA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.09",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "22644",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "45092",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "0",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "66",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "140",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.6",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Pyhäsalmi",
"unit": null
},
{
"key": "conductivity",
"value": "103.3",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 63.6812,
"accession": "ERS710570",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "R-2247",
"sample-alias": "R2247DNAB",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:26:31"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710570/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001599",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710570/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710570?format=api"
}
},
{
"type": "samples",
"id": "ERS710571",
"attributes": {
"biosample": "SAMEA3356742",
"longitude": 25.9815,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Geomikro",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "2410",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-13",
"unit": null
},
{
"key": "source material identifiers",
"value": "R-2247",
"unit": null
},
{
"key": "sample collection device or method",
"value": "free flow",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V3",
"unit": null
},
{
"key": "pcr primers",
"value": "8F/P2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "CGACGC",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.09",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "22644",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "45092",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "0",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "66",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "140",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.6",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Pyhäsalmi",
"unit": null
},
{
"key": "conductivity",
"value": "103.3",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 63.6812,
"accession": "ERS710571",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "R-2247",
"sample-alias": "R2247RNAB",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:26:31"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710571/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001599",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710571/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710571?format=api"
}
},
{
"type": "samples",
"id": "ERS710572",
"attributes": {
"biosample": "SAMEA3356743",
"longitude": 25.9815,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Geomikro",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "1920",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-14",
"unit": null
},
{
"key": "source material identifiers",
"value": "R-2250",
"unit": null
},
{
"key": "sample collection device or method",
"value": "free flow",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V3",
"unit": null
},
{
"key": "pcr primers",
"value": "8F/P2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TCTATG",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.09",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "4769",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "10103",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "0",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "92",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "40",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Pyhäsalmi",
"unit": null
},
{
"key": "conductivity",
"value": "34",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 63.6812,
"accession": "ERS710572",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "R-2250",
"sample-alias": "R2250DNAB",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:26:31"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710572/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001599",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710572/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710572?format=api"
}
},
{
"type": "samples",
"id": "ERS710573",
"attributes": {
"biosample": "SAMEA3356744",
"longitude": 25.9815,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Geomikro",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "1920",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-14",
"unit": null
},
{
"key": "source material identifiers",
"value": "R-2250",
"unit": null
},
{
"key": "sample collection device or method",
"value": "free flow",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V1-V3",
"unit": null
},
{
"key": "pcr primers",
"value": "8F/P2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TGAGCA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.09",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "4769",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "10103",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "0",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "92",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "40",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "77133",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Pyhäsalmi",
"unit": null
},
{
"key": "conductivity",
"value": "34",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 63.6812,
"accession": "ERS710573",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "R-2250",
"sample-alias": "R2250RNAB",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:26:31"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710573/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001599",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710573/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710573?format=api"
}
},
{
"type": "samples",
"id": "ERS710574",
"attributes": {
"biosample": "SAMEA3356745",
"longitude": 25.9815,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Geomikro",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "2410",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-13",
"unit": null
},
{
"key": "source material identifiers",
"value": "R-2247",
"unit": null
},
{
"key": "sample collection device or method",
"value": "free flow",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V3-V4",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ACACTG",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.09",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "22644",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "45092",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "0",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "66",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "140",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.6",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "175245",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Pyhäsalmi",
"unit": null
},
{
"key": "conductivity",
"value": "103.3",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 63.6812,
"accession": "ERS710574",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "R-2247",
"sample-alias": "R2247DNAF",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:26:31"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710574/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001599",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710574/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710574?format=api"
}
},
{
"type": "samples",
"id": "ERS710575",
"attributes": {
"biosample": "SAMEA3356746",
"longitude": 25.9815,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Geomikro",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "2410",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-13",
"unit": null
},
{
"key": "source material identifiers",
"value": "R-2247",
"unit": null
},
{
"key": "sample collection device or method",
"value": "free flow",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V3-V4",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TAGCGC",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.09",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "22644",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "45092",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "0",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "66",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "140",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.6",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "175245",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Pyhäsalmi",
"unit": null
},
{
"key": "conductivity",
"value": "103.3",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 63.6812,
"accession": "ERS710575",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "R-2247",
"sample-alias": "R2247RNAF",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:26:31"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710575/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001599",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710575/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710575?format=api"
}
},
{
"type": "samples",
"id": "ERS710576",
"attributes": {
"biosample": "SAMEA3356747",
"longitude": 25.9815,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Geomikro",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "1920",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-14",
"unit": null
},
{
"key": "source material identifiers",
"value": "R-2250",
"unit": null
},
{
"key": "sample collection device or method",
"value": "free flow",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V3-V4",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "CTGCTA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.09",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "4769",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "10103",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "0",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "92",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "40",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "175245",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Pyhäsalmi",
"unit": null
},
{
"key": "conductivity",
"value": "34",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 63.6812,
"accession": "ERS710576",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "R-2250",
"sample-alias": "R2250DNAF",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:26:31"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710576/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001599",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710576/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710576?format=api"
}
},
{
"type": "samples",
"id": "ERS710577",
"attributes": {
"biosample": "SAMEA3356748",
"longitude": 25.9815,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Geomikro",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "1920",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-14",
"unit": null
},
{
"key": "source material identifiers",
"value": "R-2250",
"unit": null
},
{
"key": "sample collection device or method",
"value": "free flow",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "V3-V4",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "CGCTAC",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.09",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "4769",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "10103",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "0",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "92",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "40",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "175245",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Pyhäsalmi",
"unit": null
},
{
"key": "conductivity",
"value": "34",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 63.6812,
"accession": "ERS710577",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "R-2250",
"sample-alias": "R2250RNAF",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:26:31"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710577/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001599",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710577/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710577?format=api"
}
},
{
"type": "samples",
"id": "ERS710578",
"attributes": {
"biosample": "SAMEA3356749",
"longitude": 25.9815,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Geomikro",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "2410",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-13",
"unit": null
},
{
"key": "source material identifiers",
"value": "R-2247",
"unit": null
},
{
"key": "sample collection device or method",
"value": "free flow",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS",
"unit": null
},
{
"key": "pcr primers",
"value": "Ar344f/Ar744r",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TACAGC",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.09",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "22644",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "45092",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "0",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "66",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "140",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.6",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Pyhäsalmi",
"unit": null
},
{
"key": "conductivity",
"value": "103.3",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 63.6812,
"accession": "ERS710578",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "R-2247",
"sample-alias": "R2247DNAA",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:26:31"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710578/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001599",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710578/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710578?format=api"
}
},
{
"type": "samples",
"id": "ERS710579",
"attributes": {
"biosample": "SAMEA3356750",
"longitude": 25.9815,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Geomikro",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "2410",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-13",
"unit": null
},
{
"key": "source material identifiers",
"value": "R-2247",
"unit": null
},
{
"key": "sample collection device or method",
"value": "free flow",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS",
"unit": null
},
{
"key": "pcr primers",
"value": "Ar344f/Ar744r",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "AGCAGC",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.09",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "22644",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "45092",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "0",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "66",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "140",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.6",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Pyhäsalmi",
"unit": null
},
{
"key": "conductivity",
"value": "103.3",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 63.6812,
"accession": "ERS710579",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "R-2247",
"sample-alias": "R2247RNAA",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:26:31"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710579/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001599",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710579/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710579?format=api"
}
},
{
"type": "samples",
"id": "ERS710580",
"attributes": {
"biosample": "SAMEA3356751",
"longitude": 25.9815,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Geomikro",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "1920",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-14",
"unit": null
},
{
"key": "source material identifiers",
"value": "R-2250",
"unit": null
},
{
"key": "sample collection device or method",
"value": "free flow",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS",
"unit": null
},
{
"key": "pcr primers",
"value": "Ar344f/Ar744r",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "ACAGCT",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.09",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "4769",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "10103",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "0",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "92",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "40",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Pyhäsalmi",
"unit": null
},
{
"key": "conductivity",
"value": "34",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 63.6812,
"accession": "ERS710580",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "R-2250",
"sample-alias": "R2250DNAA",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:26:31"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710580/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001599",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710580/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710580?format=api"
}
},
{
"type": "samples",
"id": "ERS710581",
"attributes": {
"biosample": "SAMEA3356752",
"longitude": 25.9815,
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "Geomikro",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "1920",
"unit": "m"
},
{
"key": "collection date",
"value": "2013-08-14",
"unit": null
},
{
"key": "source material identifiers",
"value": "R-2250",
"unit": null
},
{
"key": "sample collection device or method",
"value": "free flow",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "16S rRNA",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS",
"unit": null
},
{
"key": "pcr primers",
"value": "Ar344f/Ar744r",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TAGCTA",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCATCAG",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.09",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "4769",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "10103",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "0",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "92",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "40",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8.8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Pyhäsalmi",
"unit": null
},
{
"key": "conductivity",
"value": "34",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 63.6812,
"accession": "ERS710581",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "R-2250",
"sample-alias": "R2250RNAA",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:26:31"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710581/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001599",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710581/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710581?format=api"
}
},
{
"type": "samples",
"id": "ERS1073737",
"attributes": {
"biosample": "SAMEA3886603",
"longitude": 6.104,
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "RHIZORG_WGS",
"unit": null
},
{
"key": "experimental factor",
"value": "Bare soil",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "0.07",
"unit": "m"
},
{
"key": "collection date",
"value": "2014-08-11",
"unit": null
},
{
"key": "environmental package",
"value": "soil",
"unit": null
},
{
"key": "sequencing method",
"value": "MiSeq PE250",
"unit": null
},
{
"key": "geographic location (elevation)",
"value": "220",
"unit": "m"
},
{
"key": "NCBI sample classification",
"value": "410658",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS soil (ERC000022)",
"unit": null
}
],
"latitude": 48.615,
"accession": "ERS1073737",
"analysis-completed": "2016-03-11",
"collection-date": null,
"geo-loc-name": "France",
"sample-desc": "RHIZORG_WGS",
"environment-biome": "terrestrial biome",
"environment-feature": "contaminated soil",
"environment-material": "contaminated soil",
"sample-name": "NP13-J10A-WGS",
"sample-alias": "NP13-J10A-WGS",
"host-tax-id": null,
"species": null,
"last-update": "2016-03-11T10:10:04"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073737/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000628",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000628?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073737/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073737?format=api"
}
},
{
"type": "samples",
"id": "ERS1073738",
"attributes": {
"biosample": "SAMEA3886604",
"longitude": 6.104,
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "RHIZORG_WGS",
"unit": null
},
{
"key": "experimental factor",
"value": "Bare soil",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "0.07",
"unit": "m"
},
{
"key": "collection date",
"value": "2014-08-11",
"unit": null
},
{
"key": "environmental package",
"value": "soil",
"unit": null
},
{
"key": "sequencing method",
"value": "MiSeq PE250",
"unit": null
},
{
"key": "geographic location (elevation)",
"value": "220",
"unit": "m"
},
{
"key": "NCBI sample classification",
"value": "410658",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS soil (ERC000022)",
"unit": null
}
],
"latitude": 48.615,
"accession": "ERS1073738",
"analysis-completed": "2016-03-11",
"collection-date": null,
"geo-loc-name": "France",
"sample-desc": "RHIZORG_WGS",
"environment-biome": "terrestrial biome",
"environment-feature": "contaminated soil",
"environment-material": "contaminated soil",
"sample-name": "NP13-J10B-WGS",
"sample-alias": "NP13-J10B-WGS",
"host-tax-id": null,
"species": null,
"last-update": "2016-03-11T10:10:04"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073738/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000628",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000628?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073738/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073738?format=api"
}
},
{
"type": "samples",
"id": "ERS1073739",
"attributes": {
"biosample": "SAMEA3886605",
"longitude": 6.104,
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "RHIZORG_WGS",
"unit": null
},
{
"key": "experimental factor",
"value": "Bare soil",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "0.07",
"unit": "m"
},
{
"key": "collection date",
"value": "2014-08-11",
"unit": null
},
{
"key": "environmental package",
"value": "soil",
"unit": null
},
{
"key": "sequencing method",
"value": "MiSeq PE250",
"unit": null
},
{
"key": "geographic location (elevation)",
"value": "220",
"unit": "m"
},
{
"key": "NCBI sample classification",
"value": "410658",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS soil (ERC000022)",
"unit": null
}
],
"latitude": 48.615,
"accession": "ERS1073739",
"analysis-completed": "2016-03-11",
"collection-date": null,
"geo-loc-name": "France",
"sample-desc": "RHIZORG_WGS",
"environment-biome": "terrestrial biome",
"environment-feature": "contaminated soil",
"environment-material": "contaminated soil",
"sample-name": "NP13-J10C-WGS",
"sample-alias": "NP13-J10C-WGS",
"host-tax-id": null,
"species": null,
"last-update": "2016-03-11T10:10:04"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073739/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000628",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000628?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073739/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073739?format=api"
}
},
{
"type": "samples",
"id": "ERS1073740",
"attributes": {
"biosample": "SAMEA3886606",
"longitude": 6.104,
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "RHIZORG_WGS",
"unit": null
},
{
"key": "experimental factor",
"value": "Ryegrass-vegetated soil",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "0.07",
"unit": "m"
},
{
"key": "collection date",
"value": "2014-08-11",
"unit": null
},
{
"key": "environmental package",
"value": "soil",
"unit": null
},
{
"key": "sequencing method",
"value": "MiSeq PE250",
"unit": null
},
{
"key": "geographic location (elevation)",
"value": "220",
"unit": "m"
},
{
"key": "NCBI sample classification",
"value": "410658",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS soil (ERC000022)",
"unit": null
}
],
"latitude": 48.615,
"accession": "ERS1073740",
"analysis-completed": "2016-03-11",
"collection-date": null,
"geo-loc-name": "France",
"sample-desc": "RHIZORG_WGS",
"environment-biome": "terrestrial biome",
"environment-feature": "contaminated soil",
"environment-material": "contaminated soil",
"sample-name": "RG13-J10A-WGS",
"sample-alias": "RG13-J10A-WGS",
"host-tax-id": null,
"species": null,
"last-update": "2016-03-11T10:10:04"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073740/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000628",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000628?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073740/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073740?format=api"
}
},
{
"type": "samples",
"id": "ERS1073741",
"attributes": {
"biosample": "SAMEA3886607",
"longitude": 6.104,
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "RHIZORG_WGS",
"unit": null
},
{
"key": "experimental factor",
"value": "Ryegrass-vegetated soil",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "0.07",
"unit": "m"
},
{
"key": "collection date",
"value": "2014-08-11",
"unit": null
},
{
"key": "environmental package",
"value": "soil",
"unit": null
},
{
"key": "sequencing method",
"value": "MiSeq PE250",
"unit": null
},
{
"key": "geographic location (elevation)",
"value": "220",
"unit": "m"
},
{
"key": "NCBI sample classification",
"value": "410658",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS soil (ERC000022)",
"unit": null
}
],
"latitude": 48.615,
"accession": "ERS1073741",
"analysis-completed": "2016-03-11",
"collection-date": null,
"geo-loc-name": "France",
"sample-desc": "RHIZORG_WGS",
"environment-biome": "terrestrial biome",
"environment-feature": "contaminated soil",
"environment-material": "contaminated soil",
"sample-name": "RG13-J10B-WGS",
"sample-alias": "RG13-J10B-WGS",
"host-tax-id": null,
"species": null,
"last-update": "2016-03-11T10:10:04"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073741/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000628",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000628?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073741/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073741?format=api"
}
},
{
"type": "samples",
"id": "ERS1073742",
"attributes": {
"biosample": "SAMEA3886608",
"longitude": 6.104,
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "RHIZORG_WGS",
"unit": null
},
{
"key": "experimental factor",
"value": "Ryegrass-vegetated soil",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "0.07",
"unit": "m"
},
{
"key": "collection date",
"value": "2014-08-11",
"unit": null
},
{
"key": "environmental package",
"value": "soil",
"unit": null
},
{
"key": "sequencing method",
"value": "MiSeq PE250",
"unit": null
},
{
"key": "geographic location (elevation)",
"value": "220",
"unit": "m"
},
{
"key": "NCBI sample classification",
"value": "410658",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS soil (ERC000022)",
"unit": null
}
],
"latitude": 48.615,
"accession": "ERS1073742",
"analysis-completed": "2016-03-11",
"collection-date": null,
"geo-loc-name": "France",
"sample-desc": "RHIZORG_WGS",
"environment-biome": "terrestrial biome",
"environment-feature": "contaminated soil",
"environment-material": "contaminated soil",
"sample-name": "RG13-J10C-WGS",
"sample-alias": "RG13-J10C-WGS",
"host-tax-id": null,
"species": null,
"last-update": "2016-03-11T10:10:04"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073742/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000628",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000628?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073742/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073742?format=api"
}
},
{
"type": "samples",
"id": "ERS1037669",
"attributes": {
"biosample": "SAMEA3730520",
"longitude": null,
"sample-metadata": [
{
"key": "investigation type",
"value": "metagenome",
"unit": null
},
{
"key": "project name",
"value": "Effect of DNA extraction methods on the determination of the structure of microbial communities in the phosphogypsum waste heap soil",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "0.1",
"unit": "m"
},
{
"key": "collection date",
"value": "2015-09-11",
"unit": null
},
{
"key": "environmental package",
"value": "soil",
"unit": null
},
{
"key": "sequencing method",
"value": "Illumina",
"unit": null
},
{
"key": "geographic location (elevation)",
"value": "0",
"unit": "m"
},
{
"key": "NCBI sample classification",
"value": "410658",
"unit": null
},
{
"key": "instrument model",
"value": "Illumina MiSeq",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS soil (ERC000022)",
"unit": null
}
],
"latitude": null,
"accession": "ERS1037669",
"analysis-completed": "2016-01-28",
"collection-date": null,
"geo-loc-name": "Poland",
"sample-desc": "One of replicates extracted with the kit Exgene® Soil DNA mini A&A GeneAll",
"environment-biome": "phosphogypsum waste heap soil",
"environment-feature": "phosphogypsum waste heap soil",
"environment-material": "mix of soil and postproduction wastes",
"sample-name": "EX01",
"sample-alias": "EX01",
"host-tax-id": null,
"species": null,
"last-update": "2016-02-01T10:11:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Soil:Mine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1037669/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000600",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000600?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1037669/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1037669?format=api"
}
}
],
"meta": {
"pagination": {
"page": 1,
"pages": 2,
"count": 50
}
}
}