GET /metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine/samples?format=api
HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept

{
    "links": {
        "first": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine/samples?format=api&page=1",
        "last": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine/samples?format=api&page=2",
        "next": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine/samples?format=api&page=2",
        "prev": null
    },
    "data": [
        {
            "type": "samples",
            "id": "SRS1541698",
            "attributes": {
                "biosample": "SAMN05361882",
                "longitude": null,
                "sample-metadata": [
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Hangzhou",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2015-09-25",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "last update date",
                        "value": "2016-07-08",
                        "unit": null
                    }
                ],
                "latitude": null,
                "accession": "SRS1541698",
                "analysis-completed": "2019-04-06",
                "collection-date": "2015-09-25",
                "geo-loc-name": "China:Hangzhou",
                "sample-desc": "This sample has been submitted by pda|hetrue on 2016-07-08; Escherichia coli",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "25922 Delta acrAB-TGC8",
                "sample-alias": "25922 Delta acrAB-TGC8",
                "host-tax-id": null,
                "species": null,
                "last-update": "2019-04-06T13:02:27"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541698/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00004440",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00004440?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541698/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541698?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS1554806",
            "attributes": {
                "biosample": "SAMN05361883",
                "longitude": null,
                "sample-metadata": [
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Chile",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "last update date",
                        "value": "2016-07-13",
                        "unit": null
                    }
                ],
                "latitude": null,
                "accession": "SRS1554806",
                "analysis-completed": "2019-04-06",
                "collection-date": null,
                "geo-loc-name": "Chile",
                "sample-desc": "Mesocarp sample from Prunus persica cv Magique",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "MG",
                "sample-alias": "MG",
                "host-tax-id": null,
                "species": null,
                "last-update": "2019-04-06T13:02:27"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1554806/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00004440",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00004440?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1554806/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1554806?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS1554807",
            "attributes": {
                "biosample": "SAMN05361884",
                "longitude": null,
                "sample-metadata": [
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Chile",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "last update date",
                        "value": "2016-07-12",
                        "unit": null
                    }
                ],
                "latitude": null,
                "accession": "SRS1554807",
                "analysis-completed": "2019-04-06",
                "collection-date": null,
                "geo-loc-name": "Chile",
                "sample-desc": "Transcriptome analysis of peach cultivars with different harvest date under cold storage",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "RG",
                "sample-alias": "RG",
                "host-tax-id": null,
                "species": null,
                "last-update": "2019-04-06T13:02:27"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1554807/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00004440",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00004440?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1554807/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1554807?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS1541678",
            "attributes": {
                "biosample": "SAMN05361881",
                "longitude": null,
                "sample-metadata": [
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "last update date",
                        "value": "2016-07-08",
                        "unit": null
                    }
                ],
                "latitude": null,
                "accession": "SRS1541678",
                "analysis-completed": "2019-04-06",
                "collection-date": null,
                "geo-loc-name": null,
                "sample-desc": "fresh bovine oocyte",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "fresh bovine oocyte",
                "sample-alias": "fresh bovine oocyte",
                "host-tax-id": null,
                "species": null,
                "last-update": "2019-04-06T13:02:26"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541678/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00004440",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00004440?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541678/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541678?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS1541679",
            "attributes": {
                "biosample": "SAMN05361885",
                "longitude": null,
                "sample-metadata": [
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "last update date",
                        "value": "2016-07-07",
                        "unit": null
                    }
                ],
                "latitude": null,
                "accession": "SRS1541679",
                "analysis-completed": "2019-04-06",
                "collection-date": null,
                "geo-loc-name": null,
                "sample-desc": "transcriptome of fresh bovine oocyte-2",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "fresh bovine oocyte-2",
                "sample-alias": "fresh bovine oocyte-2",
                "host-tax-id": null,
                "species": null,
                "last-update": "2019-04-06T13:02:26"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541679/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00004440",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00004440?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541679/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541679?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS1541681",
            "attributes": {
                "biosample": "SAMN05361886",
                "longitude": 17.9284,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "17.92838",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "Sweden",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2016-01-01",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "59.43865",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "last update date",
                        "value": "2016-09-08",
                        "unit": null
                    }
                ],
                "latitude": 59.4387,
                "accession": "SRS1541681",
                "analysis-completed": "2019-04-06",
                "collection-date": "2016-01-01",
                "geo-loc-name": "Sweden",
                "sample-desc": "This sample has been submitted by pda|bjhall on 2016-09-08; Sapporo virus",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "S6",
                "sample-alias": "S6",
                "host-tax-id": null,
                "species": null,
                "last-update": "2019-04-06T13:02:26"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541681/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00004440",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00004440?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541681/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS1541681?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS710570",
            "attributes": {
                "biosample": "SAMEA3356741",
                "longitude": 25.9815,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Geomikro",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "2410",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-13",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "R-2247",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "free flow",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V3",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "8F/P2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "CATGCA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.09",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "22644",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "45092",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "0",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "66",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "140",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.6",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "77133",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Pyhäsalmi",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "103.3",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 63.6812,
                "accession": "ERS710570",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "R-2247",
                "sample-alias": "R2247DNAB",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:26:31"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710570/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001599",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710570/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710570?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS710571",
            "attributes": {
                "biosample": "SAMEA3356742",
                "longitude": 25.9815,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Geomikro",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "2410",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-13",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "R-2247",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "free flow",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V3",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "8F/P2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "CGACGC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.09",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "22644",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "45092",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "0",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "66",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "140",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.6",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "77133",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Pyhäsalmi",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "103.3",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 63.6812,
                "accession": "ERS710571",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "R-2247",
                "sample-alias": "R2247RNAB",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:26:31"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710571/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001599",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710571/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710571?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS710572",
            "attributes": {
                "biosample": "SAMEA3356743",
                "longitude": 25.9815,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Geomikro",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "1920",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-14",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "R-2250",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "free flow",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V3",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "8F/P2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TCTATG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.09",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "4769",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "10103",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "0",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "92",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "40",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.8",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "77133",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Pyhäsalmi",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "34",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 63.6812,
                "accession": "ERS710572",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "R-2250",
                "sample-alias": "R2250DNAB",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:26:31"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710572/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001599",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710572/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710572?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS710573",
            "attributes": {
                "biosample": "SAMEA3356744",
                "longitude": 25.9815,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Geomikro",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "1920",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-14",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "R-2250",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "free flow",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V1-V3",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "8F/P2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TGAGCA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.09",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "4769",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "10103",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "0",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "92",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "40",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.8",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "77133",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Pyhäsalmi",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "34",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 63.6812,
                "accession": "ERS710573",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "R-2250",
                "sample-alias": "R2250RNAB",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:26:31"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710573/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001599",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710573/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710573?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS710574",
            "attributes": {
                "biosample": "SAMEA3356745",
                "longitude": 25.9815,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Geomikro",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "2410",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-13",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "R-2247",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "free flow",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V3-V4",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ACACTG",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.09",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "22644",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "45092",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "0",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "66",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "140",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.6",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "175245",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Pyhäsalmi",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "103.3",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 63.6812,
                "accession": "ERS710574",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "R-2247",
                "sample-alias": "R2247DNAF",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:26:31"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710574/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001599",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710574/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710574?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS710575",
            "attributes": {
                "biosample": "SAMEA3356746",
                "longitude": 25.9815,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Geomikro",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "2410",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-13",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "R-2247",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "free flow",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V3-V4",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TAGCGC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.09",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "22644",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "45092",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "0",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "66",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "140",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.6",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "175245",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Pyhäsalmi",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "103.3",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 63.6812,
                "accession": "ERS710575",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "R-2247",
                "sample-alias": "R2247RNAF",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:26:31"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710575/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001599",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710575/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710575?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS710576",
            "attributes": {
                "biosample": "SAMEA3356747",
                "longitude": 25.9815,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Geomikro",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "1920",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-14",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "R-2250",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "free flow",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V3-V4",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "CTGCTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.09",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "4769",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "10103",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "0",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "92",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "40",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.8",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "175245",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Pyhäsalmi",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "34",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 63.6812,
                "accession": "ERS710576",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "R-2250",
                "sample-alias": "R2250DNAF",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:26:31"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710576/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001599",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710576/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710576?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS710577",
            "attributes": {
                "biosample": "SAMEA3356748",
                "longitude": 25.9815,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Geomikro",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "1920",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-14",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "R-2250",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "free flow",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "V3-V4",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "CGCTAC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.09",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "4769",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "10103",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "0",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "92",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "40",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.8",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "175245",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Pyhäsalmi",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "34",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 63.6812,
                "accession": "ERS710577",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "R-2250",
                "sample-alias": "R2250RNAF",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:26:31"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710577/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001599",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710577/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710577?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS710578",
            "attributes": {
                "biosample": "SAMEA3356749",
                "longitude": 25.9815,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Geomikro",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "2410",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-13",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "R-2247",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "free flow",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "Ar344f/Ar744r",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TACAGC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.09",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "22644",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "45092",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "0",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "66",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "140",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.6",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Pyhäsalmi",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "103.3",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 63.6812,
                "accession": "ERS710578",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "R-2247",
                "sample-alias": "R2247DNAA",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:26:31"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710578/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001599",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710578/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710578?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS710579",
            "attributes": {
                "biosample": "SAMEA3356750",
                "longitude": 25.9815,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Geomikro",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "2410",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-13",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "R-2247",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "free flow",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "Ar344f/Ar744r",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "AGCAGC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.09",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "22644",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "45092",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "0",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "66",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "140",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.6",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Pyhäsalmi",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "103.3",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 63.6812,
                "accession": "ERS710579",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "R-2247",
                "sample-alias": "R2247RNAA",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:26:31"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710579/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001599",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710579/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710579?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS710580",
            "attributes": {
                "biosample": "SAMEA3356751",
                "longitude": 25.9815,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Geomikro",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "1920",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-14",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "R-2250",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "free flow",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "Ar344f/Ar744r",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "ACAGCT",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.09",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "4769",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "10103",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "0",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "92",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "40",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.8",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Pyhäsalmi",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "34",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 63.6812,
                "accession": "ERS710580",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "R-2250",
                "sample-alias": "R2250DNAA",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:26:31"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710580/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001599",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710580/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710580?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS710581",
            "attributes": {
                "biosample": "SAMEA3356752",
                "longitude": 25.9815,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Geomikro",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "1920",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2013-08-14",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "R-2250",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "free flow",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "16S rRNA",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "Ar344f/Ar744r",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TAGCTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CGTATCGCCTCCCTCGCGCCATCAG",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.09",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "4769",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "10103",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "0",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "92",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "40",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8.8",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Pyhäsalmi",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "34",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "latitude": 63.6812,
                "accession": "ERS710581",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "R-2250",
                "sample-alias": "R2250RNAA",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:26:31"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710581/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001599",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001599?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710581/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS710581?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS1073737",
            "attributes": {
                "biosample": "SAMEA3886603",
                "longitude": 6.104,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "metagenome",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "RHIZORG_WGS",
                        "unit": null
                    },
                    {
                        "key": "experimental factor",
                        "value": "Bare soil",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "0.07",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2014-08-11",
                        "unit": null
                    },
                    {
                        "key": "environmental package",
                        "value": "soil",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "MiSeq PE250",
                        "unit": null
                    },
                    {
                        "key": "geographic location (elevation)",
                        "value": "220",
                        "unit": "m"
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "410658",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS soil (ERC000022)",
                        "unit": null
                    }
                ],
                "latitude": 48.615,
                "accession": "ERS1073737",
                "analysis-completed": "2016-03-11",
                "collection-date": null,
                "geo-loc-name": "France",
                "sample-desc": "RHIZORG_WGS",
                "environment-biome": "terrestrial biome",
                "environment-feature": "contaminated soil",
                "environment-material": "contaminated soil",
                "sample-name": "NP13-J10A-WGS",
                "sample-alias": "NP13-J10A-WGS",
                "host-tax-id": null,
                "species": null,
                "last-update": "2016-03-11T10:10:04"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073737/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000628",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000628?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073737/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073737?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS1073738",
            "attributes": {
                "biosample": "SAMEA3886604",
                "longitude": 6.104,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "metagenome",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "RHIZORG_WGS",
                        "unit": null
                    },
                    {
                        "key": "experimental factor",
                        "value": "Bare soil",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "0.07",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2014-08-11",
                        "unit": null
                    },
                    {
                        "key": "environmental package",
                        "value": "soil",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "MiSeq PE250",
                        "unit": null
                    },
                    {
                        "key": "geographic location (elevation)",
                        "value": "220",
                        "unit": "m"
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "410658",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS soil (ERC000022)",
                        "unit": null
                    }
                ],
                "latitude": 48.615,
                "accession": "ERS1073738",
                "analysis-completed": "2016-03-11",
                "collection-date": null,
                "geo-loc-name": "France",
                "sample-desc": "RHIZORG_WGS",
                "environment-biome": "terrestrial biome",
                "environment-feature": "contaminated soil",
                "environment-material": "contaminated soil",
                "sample-name": "NP13-J10B-WGS",
                "sample-alias": "NP13-J10B-WGS",
                "host-tax-id": null,
                "species": null,
                "last-update": "2016-03-11T10:10:04"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073738/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000628",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000628?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073738/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073738?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS1073739",
            "attributes": {
                "biosample": "SAMEA3886605",
                "longitude": 6.104,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "metagenome",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "RHIZORG_WGS",
                        "unit": null
                    },
                    {
                        "key": "experimental factor",
                        "value": "Bare soil",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "0.07",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2014-08-11",
                        "unit": null
                    },
                    {
                        "key": "environmental package",
                        "value": "soil",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "MiSeq PE250",
                        "unit": null
                    },
                    {
                        "key": "geographic location (elevation)",
                        "value": "220",
                        "unit": "m"
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "410658",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS soil (ERC000022)",
                        "unit": null
                    }
                ],
                "latitude": 48.615,
                "accession": "ERS1073739",
                "analysis-completed": "2016-03-11",
                "collection-date": null,
                "geo-loc-name": "France",
                "sample-desc": "RHIZORG_WGS",
                "environment-biome": "terrestrial biome",
                "environment-feature": "contaminated soil",
                "environment-material": "contaminated soil",
                "sample-name": "NP13-J10C-WGS",
                "sample-alias": "NP13-J10C-WGS",
                "host-tax-id": null,
                "species": null,
                "last-update": "2016-03-11T10:10:04"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073739/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000628",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000628?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073739/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073739?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS1073740",
            "attributes": {
                "biosample": "SAMEA3886606",
                "longitude": 6.104,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "metagenome",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "RHIZORG_WGS",
                        "unit": null
                    },
                    {
                        "key": "experimental factor",
                        "value": "Ryegrass-vegetated soil",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "0.07",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2014-08-11",
                        "unit": null
                    },
                    {
                        "key": "environmental package",
                        "value": "soil",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "MiSeq PE250",
                        "unit": null
                    },
                    {
                        "key": "geographic location (elevation)",
                        "value": "220",
                        "unit": "m"
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "410658",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS soil (ERC000022)",
                        "unit": null
                    }
                ],
                "latitude": 48.615,
                "accession": "ERS1073740",
                "analysis-completed": "2016-03-11",
                "collection-date": null,
                "geo-loc-name": "France",
                "sample-desc": "RHIZORG_WGS",
                "environment-biome": "terrestrial biome",
                "environment-feature": "contaminated soil",
                "environment-material": "contaminated soil",
                "sample-name": "RG13-J10A-WGS",
                "sample-alias": "RG13-J10A-WGS",
                "host-tax-id": null,
                "species": null,
                "last-update": "2016-03-11T10:10:04"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073740/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000628",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000628?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073740/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073740?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS1073741",
            "attributes": {
                "biosample": "SAMEA3886607",
                "longitude": 6.104,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "metagenome",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "RHIZORG_WGS",
                        "unit": null
                    },
                    {
                        "key": "experimental factor",
                        "value": "Ryegrass-vegetated soil",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "0.07",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2014-08-11",
                        "unit": null
                    },
                    {
                        "key": "environmental package",
                        "value": "soil",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "MiSeq PE250",
                        "unit": null
                    },
                    {
                        "key": "geographic location (elevation)",
                        "value": "220",
                        "unit": "m"
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "410658",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS soil (ERC000022)",
                        "unit": null
                    }
                ],
                "latitude": 48.615,
                "accession": "ERS1073741",
                "analysis-completed": "2016-03-11",
                "collection-date": null,
                "geo-loc-name": "France",
                "sample-desc": "RHIZORG_WGS",
                "environment-biome": "terrestrial biome",
                "environment-feature": "contaminated soil",
                "environment-material": "contaminated soil",
                "sample-name": "RG13-J10B-WGS",
                "sample-alias": "RG13-J10B-WGS",
                "host-tax-id": null,
                "species": null,
                "last-update": "2016-03-11T10:10:04"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073741/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000628",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000628?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073741/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073741?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS1073742",
            "attributes": {
                "biosample": "SAMEA3886608",
                "longitude": 6.104,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "metagenome",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "RHIZORG_WGS",
                        "unit": null
                    },
                    {
                        "key": "experimental factor",
                        "value": "Ryegrass-vegetated soil",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "0.07",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2014-08-11",
                        "unit": null
                    },
                    {
                        "key": "environmental package",
                        "value": "soil",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "MiSeq PE250",
                        "unit": null
                    },
                    {
                        "key": "geographic location (elevation)",
                        "value": "220",
                        "unit": "m"
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "410658",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS soil (ERC000022)",
                        "unit": null
                    }
                ],
                "latitude": 48.615,
                "accession": "ERS1073742",
                "analysis-completed": "2016-03-11",
                "collection-date": null,
                "geo-loc-name": "France",
                "sample-desc": "RHIZORG_WGS",
                "environment-biome": "terrestrial biome",
                "environment-feature": "contaminated soil",
                "environment-material": "contaminated soil",
                "sample-name": "RG13-J10C-WGS",
                "sample-alias": "RG13-J10C-WGS",
                "host-tax-id": null,
                "species": null,
                "last-update": "2016-03-11T10:10:04"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073742/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000628",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000628?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073742/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1073742?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS1037669",
            "attributes": {
                "biosample": "SAMEA3730520",
                "longitude": null,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "metagenome",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "Effect of DNA extraction methods on the determination of the structure of microbial communities in the phosphogypsum waste heap soil",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "0.1",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2015-09-11",
                        "unit": null
                    },
                    {
                        "key": "environmental package",
                        "value": "soil",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "Illumina",
                        "unit": null
                    },
                    {
                        "key": "geographic location (elevation)",
                        "value": "0",
                        "unit": "m"
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "410658",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "Illumina MiSeq",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS soil (ERC000022)",
                        "unit": null
                    }
                ],
                "latitude": null,
                "accession": "ERS1037669",
                "analysis-completed": "2016-01-28",
                "collection-date": null,
                "geo-loc-name": "Poland",
                "sample-desc": "One of replicates extracted with the kit Exgene® Soil DNA mini A&A GeneAll",
                "environment-biome": "phosphogypsum waste heap soil",
                "environment-feature": "phosphogypsum waste heap soil",
                "environment-material": "mix of soil and postproduction wastes",
                "sample-name": "EX01",
                "sample-alias": "EX01",
                "host-tax-id": null,
                "species": null,
                "last-update": "2016-02-01T10:11:55"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Soil:Mine"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Soil:Mine?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1037669/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00000600",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000600?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1037669/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS1037669?format=api"
            }
        }
    ],
    "meta": {
        "pagination": {
            "page": 1,
            "pages": 2,
            "count": 50
        }
    }
}