GET /metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic/samples?format=api
HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept

{
    "links": {
        "first": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic/samples?format=api&page=1",
        "last": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic/samples?format=api&page=4",
        "next": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic/samples?format=api&page=2",
        "prev": null
    },
    "data": [
        {
            "type": "samples",
            "id": "SRS3744611",
            "attributes": {
                "longitude": 120.13,
                "biosample": "SAMN09976045",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.13",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744611",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "204",
                "sample-alias": "204",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:13:02"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744611/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744611/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744611?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744610",
            "attributes": {
                "longitude": 120.12,
                "biosample": "SAMN09976044",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.12",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744610",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "180",
                "sample-alias": "180",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:12:23"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744610/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744610/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744610?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744609",
            "attributes": {
                "longitude": 120.11,
                "biosample": "SAMN09976043",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.11",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744609",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "168",
                "sample-alias": "168",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:11:37"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744609/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744609/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744609?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744608",
            "attributes": {
                "longitude": 120.1,
                "biosample": "SAMN09976042",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.1",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744608",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "148",
                "sample-alias": "148",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:11:11"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744608/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744608/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744608?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744605",
            "attributes": {
                "longitude": 120.9,
                "biosample": "SAMN09976041",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.9",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744605",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "120",
                "sample-alias": "120",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:10:45"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744605/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744605/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744605?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744604",
            "attributes": {
                "longitude": 120.8,
                "biosample": "SAMN09976040",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.8",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744604",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "92",
                "sample-alias": "92",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:10:14"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744604/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744604/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744604?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744603",
            "attributes": {
                "longitude": 120.7,
                "biosample": "SAMN09976039",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.7",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744603",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "80",
                "sample-alias": "80",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:09:40"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744603/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744603/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744603?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744602",
            "attributes": {
                "longitude": 120.6,
                "biosample": "SAMN09976038",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.6",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744602",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "60",
                "sample-alias": "60",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:08:57"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744602/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744602/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744602?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744601",
            "attributes": {
                "longitude": 120.5,
                "biosample": "SAMN09976037",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.5",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744601",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "30",
                "sample-alias": "30",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:08:33"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744601/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744601/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744601?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744600",
            "attributes": {
                "longitude": 120.5,
                "biosample": "SAMN09976036",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.5",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744600",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "16S V4 region sequence of sedimentary rock samples",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "2",
                "sample-alias": "2",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:07:46"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744600/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744600/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744600?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744599",
            "attributes": {
                "longitude": 120.19,
                "biosample": "SAMN09976051",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.19",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744599",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "314",
                "sample-alias": "314",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:07:17"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744599/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744599/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744599?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744598",
            "attributes": {
                "longitude": 120.18,
                "biosample": "SAMN09976050",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.18",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744598",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "310",
                "sample-alias": "310",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:06:35"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744598/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744598/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744598?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744607",
            "attributes": {
                "longitude": 120.21,
                "biosample": "SAMN09976053",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.21",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744607",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "398",
                "sample-alias": "398",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:05:48"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744607/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744607/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744607?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744597",
            "attributes": {
                "longitude": 120.2,
                "biosample": "SAMN09976052",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.2",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744597",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "378",
                "sample-alias": "378",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:05:12"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744597/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744597/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744597?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744596",
            "attributes": {
                "longitude": 120.15,
                "biosample": "SAMN09976047",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.15",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744596",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "250",
                "sample-alias": "250",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:04:34"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744596/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744596/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744596?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744592",
            "attributes": {
                "longitude": 120.14,
                "biosample": "SAMN09976046",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.14",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744592",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "212",
                "sample-alias": "212",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:03:53"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744592/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744592/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744592?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744593",
            "attributes": {
                "longitude": 120.17,
                "biosample": "SAMN09976049",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.17",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744593",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "306",
                "sample-alias": "306",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:03:28"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744593/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744593/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744593?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744594",
            "attributes": {
                "longitude": 120.16,
                "biosample": "SAMN09976048",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.16",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744594",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "282",
                "sample-alias": "282",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:03:01"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744594/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744594/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744594?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744595",
            "attributes": {
                "longitude": 120.23,
                "biosample": "SAMN09976055",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.23",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744595",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "438",
                "sample-alias": "438",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:02:35"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744595/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744595/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744595?format=api"
            }
        },
        {
            "type": "samples",
            "id": "SRS3744591",
            "attributes": {
                "longitude": 120.22,
                "biosample": "SAMN09976054",
                "latitude": 35.16,
                "sample-metadata": [
                    {
                        "key": "geographic location (longitude)",
                        "value": "120.22",
                        "unit": null
                    },
                    {
                        "key": "geographic location (country and/or sea,region)",
                        "value": "China:Linxia Basin",
                        "unit": null
                    },
                    {
                        "key": "collection date",
                        "value": "2017-10-26",
                        "unit": null
                    },
                    {
                        "key": "geographic location (latitude)",
                        "value": "35.16",
                        "unit": null
                    }
                ],
                "accession": "SRS3744591",
                "analysis-completed": null,
                "collection-date": "2017-10-26",
                "geo-loc-name": null,
                "sample-desc": "Metagenome or environmental sample from prokaryotes",
                "environment-biome": null,
                "environment-feature": null,
                "environment-material": null,
                "sample-name": "410",
                "sample-alias": "410",
                "host-tax-id": null,
                "species": null,
                "last-update": "2020-10-13T17:01:56"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744591/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00005624",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744591/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744591?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706390",
            "attributes": {
                "longitude": 21.4833,
                "biosample": "SAMEA3344960",
                "latitude": 61.2333,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "296",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2010-01-23",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR13/296m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "CTGCTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "2.19",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "460",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "2920",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "27",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "10",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "35",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.9",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "8970",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "accession": "ERS706390",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR13/296m_10",
                "sample-alias": "I362KR13DNA10",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706390/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706390/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706390?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706391",
            "attributes": {
                "longitude": 21.4833,
                "biosample": "SAMEA3344961",
                "latitude": 61.2333,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "296",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2010-09-03",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR13/296m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TAGTAT",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "2.19",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "460",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "2920",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "27",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "10",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "35",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.9",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "8970",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "accession": "ERS706391",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR13/296m_10",
                "sample-alias": "I362KR13RNA10",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706391/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706391/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706391?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706392",
            "attributes": {
                "longitude": 21.4833,
                "biosample": "SAMEA3344962",
                "latitude": 61.2333,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "296",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2012-08-21",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR13/296m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TATGTA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "1.9",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "380",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "2540",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "28",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "38",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "35",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.8",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "8070",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "accession": "ERS706392",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR13/296m_12",
                "sample-alias": "I360KR13DNA12",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706392/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706392/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706392?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706393",
            "attributes": {
                "longitude": 21.4833,
                "biosample": "SAMEA3344963",
                "latitude": 61.2333,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "296",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2012-08-21",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR13/296m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TATAGA",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "1.9",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "380",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "2540",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "28",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "38",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "35",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "7.8",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "8070",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "accession": "ERS706393",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR13/296m_12",
                "sample-alias": "I360KR13RNA12",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706393/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706393/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706393?format=api"
            }
        },
        {
            "type": "samples",
            "id": "ERS706394",
            "attributes": {
                "longitude": 21.4833,
                "biosample": "SAMEA3344964",
                "latitude": 61.2333,
                "sample-metadata": [
                    {
                        "key": "investigation type",
                        "value": "mimarks-survey",
                        "unit": null
                    },
                    {
                        "key": "project name",
                        "value": "DeepRunko",
                        "unit": null
                    },
                    {
                        "key": "geographic location (depth)",
                        "value": "303",
                        "unit": "m"
                    },
                    {
                        "key": "collection date",
                        "value": "2012-08-21",
                        "unit": null
                    },
                    {
                        "key": "source material identifiers",
                        "value": "OL-KR3/303m",
                        "unit": null
                    },
                    {
                        "key": "sample collection device or method",
                        "value": "pump",
                        "unit": null
                    },
                    {
                        "key": "sample material processing",
                        "value": "filtration",
                        "unit": null
                    },
                    {
                        "key": "amount or size of sample collected",
                        "value": "1",
                        "unit": "L"
                    },
                    {
                        "key": "nucleic acid extraction",
                        "value": "commercial kit",
                        "unit": null
                    },
                    {
                        "key": "nucleic acid amplification",
                        "value": "PCR",
                        "unit": null
                    },
                    {
                        "key": "target gene",
                        "value": "fungal ITS gene region",
                        "unit": null
                    },
                    {
                        "key": "target subfragment",
                        "value": "ITS1",
                        "unit": null
                    },
                    {
                        "key": "pcr primers",
                        "value": "ITS1F/ITS2",
                        "unit": null
                    },
                    {
                        "key": "multiplex identifiers",
                        "value": "TAGCGC",
                        "unit": null
                    },
                    {
                        "key": "adapters",
                        "value": "CTTGGTCATTTAGAGGAAGTAA",
                        "unit": null
                    },
                    {
                        "key": "sequencing method",
                        "value": "pyrosequencing",
                        "unit": null
                    },
                    {
                        "key": "alkalinity",
                        "value": "0.42",
                        "unit": "mEq/L"
                    },
                    {
                        "key": "calcium",
                        "value": "350",
                        "unit": "mg/L"
                    },
                    {
                        "key": "chloride",
                        "value": "3280",
                        "unit": "mg/L"
                    },
                    {
                        "key": "dissolved inorganic carbon",
                        "value": "4.3",
                        "unit": "µg/L"
                    },
                    {
                        "key": "dissolved organic carbon",
                        "value": "7.8",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "magnesium",
                        "value": "28",
                        "unit": "mol/L"
                    },
                    {
                        "key": "nitrate",
                        "value": "0",
                        "unit": "µmol/L"
                    },
                    {
                        "key": "pH",
                        "value": "8",
                        "unit": null
                    },
                    {
                        "key": "NCBI sample classification",
                        "value": "115547",
                        "unit": null
                    },
                    {
                        "key": "instrument model",
                        "value": "454 GS FLX Titanium",
                        "unit": null
                    },
                    {
                        "key": "ENA checklist",
                        "value": "GSC MIxS water (ERC000024)",
                        "unit": null
                    },
                    {
                        "key": "geographic location (region and locality)",
                        "value": "Olkiluoto",
                        "unit": null
                    },
                    {
                        "key": "conductivity",
                        "value": "9870",
                        "unit": "mS/cm"
                    },
                    {
                        "key": "sample volume or weight for DNA extraction",
                        "value": "1000",
                        "unit": "mL"
                    },
                    {
                        "key": "water environmental package",
                        "value": "water",
                        "unit": null
                    }
                ],
                "accession": "ERS706394",
                "analysis-completed": "2017-03-17",
                "collection-date": null,
                "geo-loc-name": "Finland",
                "sample-desc": "groundwater",
                "environment-biome": "deep subsurface",
                "environment-feature": "crystalline bedrock",
                "environment-material": "groundwater",
                "sample-name": "OL-KR3/303m_12",
                "sample-alias": "I339KR03DNA12",
                "host-tax-id": null,
                "species": null,
                "last-update": "2017-03-17T10:03:34"
            },
            "relationships": {
                "biome": {
                    "data": {
                        "type": "biomes",
                        "id": "root:Environmental:Terrestrial:Geologic"
                    },
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
                    }
                },
                "studies": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706394/studies?format=api"
                    },
                    "data": [
                        {
                            "type": "studies",
                            "id": "MGYS00001597",
                            "links": {
                                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
                            }
                        }
                    ]
                },
                "runs": {
                    "links": {
                        "related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706394/runs?format=api"
                    }
                }
            },
            "links": {
                "self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706394?format=api"
            }
        }
    ],
    "meta": {
        "pagination": {
            "page": 1,
            "pages": 4,
            "count": 85
        }
    }
}