HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept
{
"links": {
"first": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic/samples?format=api&page=1",
"last": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic/samples?format=api&page=4",
"next": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic/samples?format=api&page=2",
"prev": null
},
"data": [
{
"type": "samples",
"id": "SRS3744611",
"attributes": {
"longitude": 120.13,
"biosample": "SAMN09976045",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.13",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744611",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "204",
"sample-alias": "204",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:13:02"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744611/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744611/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744611?format=api"
}
},
{
"type": "samples",
"id": "SRS3744610",
"attributes": {
"longitude": 120.12,
"biosample": "SAMN09976044",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.12",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744610",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "180",
"sample-alias": "180",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:12:23"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744610/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744610/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744610?format=api"
}
},
{
"type": "samples",
"id": "SRS3744609",
"attributes": {
"longitude": 120.11,
"biosample": "SAMN09976043",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.11",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744609",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "168",
"sample-alias": "168",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:11:37"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744609/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744609/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744609?format=api"
}
},
{
"type": "samples",
"id": "SRS3744608",
"attributes": {
"longitude": 120.1,
"biosample": "SAMN09976042",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.1",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744608",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "148",
"sample-alias": "148",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:11:11"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744608/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744608/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744608?format=api"
}
},
{
"type": "samples",
"id": "SRS3744605",
"attributes": {
"longitude": 120.9,
"biosample": "SAMN09976041",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.9",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744605",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "120",
"sample-alias": "120",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:10:45"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744605/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744605/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744605?format=api"
}
},
{
"type": "samples",
"id": "SRS3744604",
"attributes": {
"longitude": 120.8,
"biosample": "SAMN09976040",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.8",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744604",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "92",
"sample-alias": "92",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:10:14"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744604/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744604/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744604?format=api"
}
},
{
"type": "samples",
"id": "SRS3744603",
"attributes": {
"longitude": 120.7,
"biosample": "SAMN09976039",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.7",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744603",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "80",
"sample-alias": "80",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:09:40"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744603/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744603/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744603?format=api"
}
},
{
"type": "samples",
"id": "SRS3744602",
"attributes": {
"longitude": 120.6,
"biosample": "SAMN09976038",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.6",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744602",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "60",
"sample-alias": "60",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:08:57"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744602/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744602/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744602?format=api"
}
},
{
"type": "samples",
"id": "SRS3744601",
"attributes": {
"longitude": 120.5,
"biosample": "SAMN09976037",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.5",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744601",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "30",
"sample-alias": "30",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:08:33"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744601/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744601/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744601?format=api"
}
},
{
"type": "samples",
"id": "SRS3744600",
"attributes": {
"longitude": 120.5,
"biosample": "SAMN09976036",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.5",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744600",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "16S V4 region sequence of sedimentary rock samples",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "2",
"sample-alias": "2",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:07:46"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744600/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744600/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744600?format=api"
}
},
{
"type": "samples",
"id": "SRS3744599",
"attributes": {
"longitude": 120.19,
"biosample": "SAMN09976051",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.19",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744599",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "314",
"sample-alias": "314",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:07:17"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744599/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744599/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744599?format=api"
}
},
{
"type": "samples",
"id": "SRS3744598",
"attributes": {
"longitude": 120.18,
"biosample": "SAMN09976050",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.18",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744598",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "310",
"sample-alias": "310",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:06:35"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744598/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744598/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744598?format=api"
}
},
{
"type": "samples",
"id": "SRS3744607",
"attributes": {
"longitude": 120.21,
"biosample": "SAMN09976053",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.21",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744607",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "398",
"sample-alias": "398",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:05:48"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744607/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744607/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744607?format=api"
}
},
{
"type": "samples",
"id": "SRS3744597",
"attributes": {
"longitude": 120.2,
"biosample": "SAMN09976052",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.2",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744597",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "378",
"sample-alias": "378",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:05:12"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744597/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744597/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744597?format=api"
}
},
{
"type": "samples",
"id": "SRS3744596",
"attributes": {
"longitude": 120.15,
"biosample": "SAMN09976047",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.15",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744596",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "250",
"sample-alias": "250",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:04:34"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744596/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744596/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744596?format=api"
}
},
{
"type": "samples",
"id": "SRS3744592",
"attributes": {
"longitude": 120.14,
"biosample": "SAMN09976046",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.14",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744592",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "212",
"sample-alias": "212",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:03:53"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744592/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744592/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744592?format=api"
}
},
{
"type": "samples",
"id": "SRS3744593",
"attributes": {
"longitude": 120.17,
"biosample": "SAMN09976049",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.17",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744593",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "306",
"sample-alias": "306",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:03:28"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744593/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744593/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744593?format=api"
}
},
{
"type": "samples",
"id": "SRS3744594",
"attributes": {
"longitude": 120.16,
"biosample": "SAMN09976048",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.16",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744594",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "282",
"sample-alias": "282",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:03:01"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744594/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744594/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744594?format=api"
}
},
{
"type": "samples",
"id": "SRS3744595",
"attributes": {
"longitude": 120.23,
"biosample": "SAMN09976055",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.23",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744595",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "438",
"sample-alias": "438",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:02:35"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744595/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744595/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744595?format=api"
}
},
{
"type": "samples",
"id": "SRS3744591",
"attributes": {
"longitude": 120.22,
"biosample": "SAMN09976054",
"sample-metadata": [
{
"key": "geographic location (longitude)",
"value": "120.22",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "China:Linxia Basin",
"unit": null
},
{
"key": "collection date",
"value": "2017-10-26",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "35.16",
"unit": null
}
],
"latitude": 35.16,
"accession": "SRS3744591",
"analysis-completed": null,
"collection-date": "2017-10-26",
"geo-loc-name": null,
"sample-desc": "Metagenome or environmental sample from prokaryotes",
"environment-biome": null,
"environment-feature": null,
"environment-material": null,
"sample-name": "410",
"sample-alias": "410",
"host-tax-id": null,
"species": null,
"last-update": "2020-10-13T17:01:56"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744591/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744591/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00005624",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00005624?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/SRS3744591?format=api"
}
},
{
"type": "samples",
"id": "ERS706390",
"attributes": {
"longitude": 21.4833,
"biosample": "SAMEA3344960",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "296",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-01-23",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR13/296m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "CTGCTA",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "2.19",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "460",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "2920",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "27",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "10",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "35",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.9",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "8970",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"accession": "ERS706390",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR13/296m_10",
"sample-alias": "I362KR13DNA10",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706390/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706390/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706390?format=api"
}
},
{
"type": "samples",
"id": "ERS706391",
"attributes": {
"longitude": 21.4833,
"biosample": "SAMEA3344961",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "296",
"unit": "m"
},
{
"key": "collection date",
"value": "2010-09-03",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR13/296m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TAGTAT",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "2.19",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "460",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "2920",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "27",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "10",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "35",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.9",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "8970",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"accession": "ERS706391",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR13/296m_10",
"sample-alias": "I362KR13RNA10",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706391/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706391/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706391?format=api"
}
},
{
"type": "samples",
"id": "ERS706392",
"attributes": {
"longitude": 21.4833,
"biosample": "SAMEA3344962",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "296",
"unit": "m"
},
{
"key": "collection date",
"value": "2012-08-21",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR13/296m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TATGTA",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "1.9",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "380",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "2540",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "28",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "38",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "35",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "8070",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"accession": "ERS706392",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR13/296m_12",
"sample-alias": "I360KR13DNA12",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706392/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706392/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706392?format=api"
}
},
{
"type": "samples",
"id": "ERS706393",
"attributes": {
"longitude": 21.4833,
"biosample": "SAMEA3344963",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "296",
"unit": "m"
},
{
"key": "collection date",
"value": "2012-08-21",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR13/296m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TATAGA",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "1.9",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "380",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "2540",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "28",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "38",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "35",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "7.8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "8070",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"accession": "ERS706393",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR13/296m_12",
"sample-alias": "I360KR13RNA12",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706393/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706393/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706393?format=api"
}
},
{
"type": "samples",
"id": "ERS706394",
"attributes": {
"longitude": 21.4833,
"biosample": "SAMEA3344964",
"sample-metadata": [
{
"key": "investigation type",
"value": "mimarks-survey",
"unit": null
},
{
"key": "project name",
"value": "DeepRunko",
"unit": null
},
{
"key": "geographic location (depth)",
"value": "303",
"unit": "m"
},
{
"key": "collection date",
"value": "2012-08-21",
"unit": null
},
{
"key": "source material identifiers",
"value": "OL-KR3/303m",
"unit": null
},
{
"key": "sample collection device or method",
"value": "pump",
"unit": null
},
{
"key": "sample material processing",
"value": "filtration",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "L"
},
{
"key": "nucleic acid extraction",
"value": "commercial kit",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "PCR",
"unit": null
},
{
"key": "target gene",
"value": "fungal ITS gene region",
"unit": null
},
{
"key": "target subfragment",
"value": "ITS1",
"unit": null
},
{
"key": "pcr primers",
"value": "ITS1F/ITS2",
"unit": null
},
{
"key": "multiplex identifiers",
"value": "TAGCGC",
"unit": null
},
{
"key": "adapters",
"value": "CTTGGTCATTTAGAGGAAGTAA",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "alkalinity",
"value": "0.42",
"unit": "mEq/L"
},
{
"key": "calcium",
"value": "350",
"unit": "mg/L"
},
{
"key": "chloride",
"value": "3280",
"unit": "mg/L"
},
{
"key": "dissolved inorganic carbon",
"value": "4.3",
"unit": "µg/L"
},
{
"key": "dissolved organic carbon",
"value": "7.8",
"unit": "µmol/L"
},
{
"key": "magnesium",
"value": "28",
"unit": "mol/L"
},
{
"key": "nitrate",
"value": "0",
"unit": "µmol/L"
},
{
"key": "pH",
"value": "8",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "115547",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
},
{
"key": "ENA checklist",
"value": "GSC MIxS water (ERC000024)",
"unit": null
},
{
"key": "geographic location (region and locality)",
"value": "Olkiluoto",
"unit": null
},
{
"key": "conductivity",
"value": "9870",
"unit": "mS/cm"
},
{
"key": "sample volume or weight for DNA extraction",
"value": "1000",
"unit": "mL"
},
{
"key": "water environmental package",
"value": "water",
"unit": null
}
],
"latitude": 61.2333,
"accession": "ERS706394",
"analysis-completed": "2017-03-17",
"collection-date": null,
"geo-loc-name": "Finland",
"sample-desc": "groundwater",
"environment-biome": "deep subsurface",
"environment-feature": "crystalline bedrock",
"environment-material": "groundwater",
"sample-name": "OL-KR3/303m_12",
"sample-alias": "I339KR03DNA12",
"host-tax-id": null,
"species": null,
"last-update": "2017-03-17T10:03:34"
},
"relationships": {
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706394/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Terrestrial:Geologic"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Terrestrial:Geologic?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706394/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00001597",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00001597?format=api"
}
}
]
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS706394?format=api"
}
}
],
"meta": {
"pagination": {
"page": 1,
"pages": 4,
"count": 85
}
}
}