Reagent summary: sequence, alignment information, cellular phenotypes observed

Reagent summary

Reagent information:

Sequence:

  UAAAGUUCUUUUAUCCAUUTT
AGAUUUCAAGAAAAUAGGUAA

This reagent is mapping several genes, see below

Gene(s) mapped:

— Total: 3

Phenotypes observed:

Observed phenotypes (?): These terms represent the phenotypic classes observed following the suppression of the expression of the selected gene across independent screens	Assigned ontology terms (?): These terms represent the cellular phenotype ontology terms assigned to the observed phenotypes	Evidence	Screen	*In set ^)**
Accumulation of GFP-RNF168 on nuclear bodies Increased nuclear body size Bright nuclear body synonyms: Increased intensity of nuclear body 1 G1_SyM_1 phenotype view: 76 / 128 ontology view: 76 / 128

*) Number of gene/reagents with the same phenotype(s) (unique mapping)
NB: this reagent maps several genes listed above