HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept
{
"links": {
"first": "https://www.ebi.ac.uk/metagenomics/api/v1/samples?format=api&page=1",
"last": "https://www.ebi.ac.uk/metagenomics/api/v1/samples?format=api&page=17433",
"next": "https://www.ebi.ac.uk/metagenomics/api/v1/samples?format=api&page=17422",
"prev": "https://www.ebi.ac.uk/metagenomics/api/v1/samples?format=api&page=17420"
},
"data": [
{
"type": "samples",
"id": "ERS161392",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "25.38",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C10.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128246",
"longitude": -0.3744,
"accession": "ERS161392",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 10 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 10 (amplicon)",
"sample-alias": " C10.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161392/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161392/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161392?format=api"
}
},
{
"type": "samples",
"id": "ERS161393",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "Intestinal tissue sample from Crohn's patient 11",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "< 0.2",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "IC1.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128221",
"longitude": -0.3744,
"accession": "ERS161393",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Intestinal tissue sample from Crohn's patient 11",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "Intestinal tissue sample from Crohn's patient 11",
"sample-name": "Intestinal tissue sample from Crohn's patient 11",
"sample-alias": " IC1.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161393/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161393/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161393?format=api"
}
},
{
"type": "samples",
"id": "ERS161394",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "Intestinal tissue sample from Crohn's patient 11",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "< 0.2",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "IC1.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128242",
"longitude": -0.3744,
"accession": "ERS161394",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Intestinal tissue sample from Crohn's patient 11 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "Intestinal tissue sample from Crohn's patient 11",
"sample-name": "Intestinal tissue sample from Crohn's patient 11 (amplicon)",
"sample-alias": " IC1.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161394/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161394/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161394?format=api"
}
},
{
"type": "samples",
"id": "ERS161395",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "14.93",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V1.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128214",
"longitude": -0.3744,
"accession": "ERS161395",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 1",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 1",
"sample-alias": " V1.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161395/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161395/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161395?format=api"
}
},
{
"type": "samples",
"id": "ERS161396",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "14.93",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V1.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128224",
"longitude": -0.3744,
"accession": "ERS161396",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 1 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 1 (amplicon)",
"sample-alias": " V1.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161396/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161396/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161396?format=api"
}
},
{
"type": "samples",
"id": "ERS161397",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "10.57",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V2.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128248",
"longitude": -0.3744,
"accession": "ERS161397",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 2",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 2",
"sample-alias": " V2.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161397/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161397/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161397?format=api"
}
},
{
"type": "samples",
"id": "ERS161398",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "10.57",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V2.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128240",
"longitude": -0.3744,
"accession": "ERS161398",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 2 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 2 (amplicon)",
"sample-alias": " V2.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161398/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161398/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161398?format=api"
}
},
{
"type": "samples",
"id": "ERS161399",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "11.88",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V3.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128216",
"longitude": -0.3744,
"accession": "ERS161399",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 3",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 3",
"sample-alias": " V3.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161399/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161399/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161399?format=api"
}
},
{
"type": "samples",
"id": "ERS161400",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "11.88",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V3.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128238",
"longitude": -0.3744,
"accession": "ERS161400",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 3 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 3 (amplicon)",
"sample-alias": " V3.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161400/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161400/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161400?format=api"
}
},
{
"type": "samples",
"id": "ERS161401",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "13.26",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V4.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128235",
"longitude": -0.3744,
"accession": "ERS161401",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 4",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 4",
"sample-alias": " V4.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161401/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161401/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161401?format=api"
}
},
{
"type": "samples",
"id": "ERS161402",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "13.26",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V4.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128247",
"longitude": -0.3744,
"accession": "ERS161402",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 4 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 4 (amplicon)",
"sample-alias": " V4.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161402/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161402/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161402?format=api"
}
},
{
"type": "samples",
"id": "ERS161403",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "13.92",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V5.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128231",
"longitude": -0.3744,
"accession": "ERS161403",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 5",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 5",
"sample-alias": " V5.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161403/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161403/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161403?format=api"
}
},
{
"type": "samples",
"id": "ERS161404",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "13.92",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V5.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128207",
"longitude": -0.3744,
"accession": "ERS161404",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 5 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 5 (amplicon)",
"sample-alias": " V5.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161404/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161404/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161404?format=api"
}
},
{
"type": "samples",
"id": "ERS161405",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "12.25",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V6.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128237",
"longitude": -0.3744,
"accession": "ERS161405",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 6",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 6",
"sample-alias": " V6.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161405/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161405/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161405?format=api"
}
},
{
"type": "samples",
"id": "ERS161406",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "12.25",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V6.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128212",
"longitude": -0.3744,
"accession": "ERS161406",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 6 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 6 (amplicon)",
"sample-alias": " V6.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161406/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161406/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161406?format=api"
}
},
{
"type": "samples",
"id": "ERS161407",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "13.38",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V7.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128213",
"longitude": -0.3744,
"accession": "ERS161407",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 7",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 7",
"sample-alias": " V7.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161407/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161407/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161407?format=api"
}
},
{
"type": "samples",
"id": "ERS161408",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "13.38",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V7.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128241",
"longitude": -0.3744,
"accession": "ERS161408",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 7 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 7 (amplicon)",
"sample-alias": " V7.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161408/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161408/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161408?format=api"
}
},
{
"type": "samples",
"id": "ERS161409",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "8.43",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V8.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128206",
"longitude": -0.3744,
"accession": "ERS161409",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 8",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 8",
"sample-alias": " V8.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161409/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161409/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161409?format=api"
}
},
{
"type": "samples",
"id": "ERS161410",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "March 2012",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "8.43",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
"unit": null
},
{
"key": "disease status",
"value": null,
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "none",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "V8.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4767,
"biosample": "SAMEA2128210",
"longitude": -0.3744,
"accession": "ERS161410",
"analysis-completed": "2013-07-25",
"collection-date": "2012-03-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from control volunteer 8 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from control volunteer 8 (amplicon)",
"sample-alias": " V8.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161410/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161410/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161410?format=api"
}
},
{
"type": "samples",
"id": "ERS167138",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "°C"
},
{
"key": "sex",
"value": "female",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "-0.3775",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain",
"unit": null
},
{
"key": "collection date",
"value": "25/06/2010",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "environmental package",
"value": "human-gut",
"unit": null
},
{
"key": "sample collection device or method",
"value": "Feces were self-collected by the volunteers in tubes containing 10 mL of phosphate buffered saline (PBS). Samples were kept at 4 �C until their storage at -80 �C (approximately 2 hours after being collected)",
"unit": null
},
{
"key": "sample material processing",
"value": "Before nucleic acid extraction, fecal samples were resuspended in PBS and centrifuged at 4,000 rpm for 3 min to remove fecal debris. 1-4 mL of the supernatants were centrifuged at 14,000 rpm for 3 min to recover cell pellets",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "DNA and RNA were simultaneously extracted from cell pellets using the AllPrep DNA/RNA Mini Kit (QIAGEN)",
"unit": null
},
{
"key": "age",
"value": "62",
"unit": null
},
{
"key": "body product",
"value": "feces",
"unit": null
},
{
"key": "body-mass index",
"value": "27.5",
"unit": null
},
{
"key": "diet",
"value": "mediterranean diet",
"unit": null
},
{
"key": "disease status",
"value": "bowel symptoms: presence of abdominal pain, abdominal distension and defecatory urgency; 2 stools (1 in form of diarrhea)",
"unit": null
},
{
"key": "family relationship",
"value": "wife of C1",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "IHMC ethnicity",
"value": "caucasian",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.46972222",
"unit": null
},
{
"key": "gastrointestinal tract disorder",
"value": "irritable bowel syndrome, diarrhoea subtype",
"unit": null
},
{
"key": "smoker",
"value": "ex-smoker",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4697,
"biosample": "SAMEA2164672",
"longitude": -0.3775,
"accession": "ERS167138",
"analysis-completed": "2012-08-29",
"collection-date": "2010-06-25",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "fecal sample of Patient 1 (IBS-diarrhea) on day 3 of the follow-up; bowel symptoms: presence of abdominal pain, abdominal distension and defecatory urgency, 2 stools (1 in form of diarrhea)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Patient 1 Day 3",
"sample-alias": "P1-D3",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167138/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000308",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000308?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167138/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167138?format=api"
}
},
{
"type": "samples",
"id": "ERS167140",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "°C"
},
{
"key": "sex",
"value": "female",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "-0.3775",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain",
"unit": null
},
{
"key": "collection date",
"value": "29/06/2010",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "environmental package",
"value": "human-gut",
"unit": null
},
{
"key": "sample collection device or method",
"value": "Feces were self-collected by the volunteers in tubes containing 10 mL of phosphate buffered saline (PBS). Samples were kept at 4 �C until their storage at -80 �C (approximately 2 hours after being collected)",
"unit": null
},
{
"key": "sample material processing",
"value": "Before nucleic acid extraction, fecal samples were resuspended in PBS and centrifuged at 4,000 rpm for 3 min to remove fecal debris. 1-4 mL of the supernatants were centrifuged at 14,000 rpm for 3 min to recover cell pellets",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "DNA and RNA were simultaneously extracted from cell pellets using the AllPrep DNA/RNA Mini Kit (QIAGEN)",
"unit": null
},
{
"key": "age",
"value": "62",
"unit": null
},
{
"key": "body product",
"value": "feces",
"unit": null
},
{
"key": "body-mass index",
"value": "27.5",
"unit": null
},
{
"key": "diet",
"value": "mediterranean diet",
"unit": null
},
{
"key": "disease status",
"value": "bowel symptoms: presence of abdominal pain, abdominal distension and defecatory urgency; 2 stools (1 in form of diarrhea)",
"unit": null
},
{
"key": "family relationship",
"value": "wife of C1",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "IHMC ethnicity",
"value": "caucasian",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.46972222",
"unit": null
},
{
"key": "gastrointestinal tract disorder",
"value": "irritable bowel syndrome, diarrhoea subtype",
"unit": null
},
{
"key": "smoker",
"value": "ex-smoker",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4697,
"biosample": "SAMEA2164664",
"longitude": -0.3775,
"accession": "ERS167140",
"analysis-completed": "2012-08-29",
"collection-date": "2010-06-29",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "fecal sample of Patient 1 (IBS-diarrhea) on day 7 of the follow-up; bowel symptoms: presence of abdominal pain, abdominal distension and defecatory urgency, 2 stools (1 in form of diarrhea)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Patient 1 Day 7",
"sample-alias": "P1-D7",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167140/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000308",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000308?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167140/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167140?format=api"
}
},
{
"type": "samples",
"id": "ERS167141",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "°C"
},
{
"key": "sex",
"value": "female",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "-0.3775",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain",
"unit": null
},
{
"key": "collection date",
"value": "06/07/2010",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "environmental package",
"value": "human-gut",
"unit": null
},
{
"key": "sample collection device or method",
"value": "Feces were self-collected by the volunteers in tubes containing 10 mL of phosphate buffered saline (PBS). Samples were kept at 4 �C until their storage at -80 �C (approximately 2 hours after being collected)",
"unit": null
},
{
"key": "sample material processing",
"value": "Before nucleic acid extraction, fecal samples were resuspended in PBS and centrifuged at 4,000 rpm for 3 min to remove fecal debris. 1-4 mL of the supernatants were centrifuged at 14,000 rpm for 3 min to recover cell pellets",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "DNA and RNA were simultaneously extracted from cell pellets using the AllPrep DNA/RNA Mini Kit (QIAGEN)",
"unit": null
},
{
"key": "age",
"value": "62",
"unit": null
},
{
"key": "body product",
"value": "feces",
"unit": null
},
{
"key": "body-mass index",
"value": "27.5",
"unit": null
},
{
"key": "diet",
"value": "mediterranean diet",
"unit": null
},
{
"key": "disease status",
"value": "bowel symptoms: presence of abdominal pain, abdominal distension and defecatory urgency; 4 stools (2 in form of diarrhea)",
"unit": null
},
{
"key": "family relationship",
"value": "wife of C1",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "IHMC ethnicity",
"value": "caucasian",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.46972222",
"unit": null
},
{
"key": "gastrointestinal tract disorder",
"value": "irritable bowel syndrome, diarrhoea subtype",
"unit": null
},
{
"key": "smoker",
"value": "ex-smoker",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4697,
"biosample": "SAMEA2164654",
"longitude": -0.3775,
"accession": "ERS167141",
"analysis-completed": "2012-08-29",
"collection-date": "2010-07-06",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "fecal sample of Patient 1 (IBS-diarrhea) on day 14 of the follow-up; bowel symptoms: presence of abdominal pain, abdominal distension and defecatory urgency, 4 stools (2 in form of diarrhea)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Patient 1 Day 14",
"sample-alias": "P1-D14",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167141/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000308",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000308?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167141/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167141?format=api"
}
},
{
"type": "samples",
"id": "ERS167142",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "°C"
},
{
"key": "sex",
"value": "female",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "-0.3775",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain",
"unit": null
},
{
"key": "collection date",
"value": "13/07/2010",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "environmental package",
"value": "human-gut",
"unit": null
},
{
"key": "sample collection device or method",
"value": "Feces were self-collected by the volunteers in tubes containing 10 mL of phosphate buffered saline (PBS). Samples were kept at 4 �C until their storage at -80 �C (approximately 2 hours after being collected)",
"unit": null
},
{
"key": "sample material processing",
"value": "Before nucleic acid extraction, fecal samples were resuspended in PBS and centrifuged at 4,000 rpm for 3 min to remove fecal debris. 1-4 mL of the supernatants were centrifuged at 14,000 rpm for 3 min to recover cell pellets",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "DNA and RNA were simultaneously extracted from cell pellets using the AllPrep DNA/RNA Mini Kit (QIAGEN)",
"unit": null
},
{
"key": "age",
"value": "62",
"unit": null
},
{
"key": "body product",
"value": "feces",
"unit": null
},
{
"key": "body-mass index",
"value": "27.5",
"unit": null
},
{
"key": "diet",
"value": "mediterranean diet",
"unit": null
},
{
"key": "disease status",
"value": "bowel symptoms: presence of abdominal pain; 3 stools (2 in form of diarrhea) ",
"unit": null
},
{
"key": "family relationship",
"value": "wife of C1",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "IHMC ethnicity",
"value": "caucasian",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.46972222",
"unit": null
},
{
"key": "gastrointestinal tract disorder",
"value": "irritable bowel syndrome, diarrhoea subtype",
"unit": null
},
{
"key": "smoker",
"value": "ex-smoker",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4697,
"biosample": "SAMEA2164674",
"longitude": -0.3775,
"accession": "ERS167142",
"analysis-completed": "2012-08-29",
"collection-date": "2010-07-13",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "fecal sample of Patient 1 (IBS-diarrhea) on day 21 of the follow-up; bowel symptoms: presence of abdominal pain, 3 stools (2 in form of diarrhea) ",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Patient 1 Day 21",
"sample-alias": "P1-D21",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167142/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000308",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000308?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167142/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167142?format=api"
}
},
{
"type": "samples",
"id": "ERS167151",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "°C"
},
{
"key": "sex",
"value": "female",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "-0.3775",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain",
"unit": null
},
{
"key": "collection date",
"value": "06/07/2010",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "environmental package",
"value": "human-gut",
"unit": null
},
{
"key": "sample collection device or method",
"value": "Feces were self-collected by the volunteers in tubes containing 10 mL of phosphate buffered saline (PBS). Samples were kept at 4 �C until their storage at -80 �C (approximately 2 hours after being collected)",
"unit": null
},
{
"key": "sample material processing",
"value": "Before nucleic acid extraction, fecal samples were resuspended in PBS and centrifuged at 4,000 rpm for 3 min to remove fecal debris. 1-4 mL of the supernatants were centrifuged at 14,000 rpm for 3 min to recover cell pellets",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "DNA and RNA were simultaneously extracted from cell pellets using the AllPrep DNA/RNA Mini Kit (QIAGEN)",
"unit": null
},
{
"key": "age",
"value": "21",
"unit": null
},
{
"key": "body product",
"value": "feces",
"unit": null
},
{
"key": "body-mass index",
"value": "30.4",
"unit": null
},
{
"key": "diet",
"value": "mediterranean diet",
"unit": null
},
{
"key": "disease status",
"value": "bowel symptoms: 4 stools (4 in form of diarrhea) ",
"unit": null
},
{
"key": "family relationship",
"value": "unrelated to P1 and C1",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "IHMC ethnicity",
"value": "caucasian",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.46972222",
"unit": null
},
{
"key": "gastrointestinal tract disorder",
"value": "irritable bowel syndrome, diarrhoea subtype",
"unit": null
},
{
"key": "smoker",
"value": "smoker",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4697,
"biosample": "SAMEA2164647",
"longitude": -0.3775,
"accession": "ERS167151",
"analysis-completed": "2012-08-29",
"collection-date": "2010-07-06",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "fecal sample of Patient 2 (IBS-diarrhea) on day 7 of the follow-up; bowel symptoms: 4 stools (4 in form of diarrhea) ",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Patient 2 Day 7",
"sample-alias": "P2-D7",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167151/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000308",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000308?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167151/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167151?format=api"
}
},
{
"type": "samples",
"id": "ERS167153",
"attributes": {
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "°C"
},
{
"key": "sex",
"value": "female",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "-0.3775",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain",
"unit": null
},
{
"key": "collection date",
"value": "20/07/2010",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "environmental package",
"value": "human-gut",
"unit": null
},
{
"key": "sample collection device or method",
"value": "Feces were self-collected by the volunteers in tubes containing 10 mL of phosphate buffered saline (PBS). Samples were kept at 4 �C until their storage at -80 �C (approximately 2 hours after being collected)",
"unit": null
},
{
"key": "sample material processing",
"value": "Before nucleic acid extraction, fecal samples were resuspended in PBS and centrifuged at 4,000 rpm for 3 min to remove fecal debris. 1-4 mL of the supernatants were centrifuged at 14,000 rpm for 3 min to recover cell pellets",
"unit": null
},
{
"key": "nucleic acid extraction",
"value": "DNA and RNA were simultaneously extracted from cell pellets using the AllPrep DNA/RNA Mini Kit (QIAGEN)",
"unit": null
},
{
"key": "age",
"value": "21",
"unit": null
},
{
"key": "body product",
"value": "feces",
"unit": null
},
{
"key": "body-mass index",
"value": "30.4",
"unit": null
},
{
"key": "diet",
"value": "mediterranean diet",
"unit": null
},
{
"key": "disease status",
"value": "bowel symptoms: presence of abdominal pain, abdominal distension and defecatory urgency; 5 stools (5 in form of diarrhea)",
"unit": null
},
{
"key": "family relationship",
"value": "unrelated to P1 and C1",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "IHMC ethnicity",
"value": "caucasian",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.46972222",
"unit": null
},
{
"key": "gastrointestinal tract disorder",
"value": "irritable bowel syndrome, diarrhoea subtype",
"unit": null
},
{
"key": "smoker",
"value": "smoker",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"latitude": 39.4697,
"biosample": "SAMEA2164667",
"longitude": -0.3775,
"accession": "ERS167153",
"analysis-completed": "2012-08-29",
"collection-date": "2010-07-20",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "fecal sample of Patient 2 (IBS-diarrhea) on day 21 of the follow-up; bowel symptoms: presence of abdominal pain, abdominal distension and defecatory urgency, 5 stools (5 in form of diarrhea)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Patient 2 Day 21",
"sample-alias": "P2-D21",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167153/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000308",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000308?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167153/runs?format=api"
}
},
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS167153?format=api"
}
}
],
"meta": {
"pagination": {
"page": 17421,
"pages": 17433,
"count": 435812
}
}
}