HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept
{
"links": {
"first": "https://www.ebi.ac.uk/metagenomics/api/v1/samples?format=api&page=1",
"last": "https://www.ebi.ac.uk/metagenomics/api/v1/samples?format=api&page=17433",
"next": "https://www.ebi.ac.uk/metagenomics/api/v1/samples?format=api&page=17421",
"prev": "https://www.ebi.ac.uk/metagenomics/api/v1/samples?format=api&page=17419"
},
"data": [
{
"type": "samples",
"id": "ERS095016",
"attributes": {
"latitude": 54.1917,
"longitude": 7.9,
"biosample": "SAMEA1318009",
"sample-metadata": [
{
"key": "silicate",
"value": "0.17",
"unit": null
},
{
"key": "temperature",
"value": "6.4",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "7.9",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Germany, Heligoland, North Sea",
"unit": null
},
{
"key": "collection date",
"value": "14-ARP-09",
"unit": null
},
{
"key": "environment (biome)",
"value": "neritic epipelagic zone biome ENVO:01000042",
"unit": null
},
{
"key": "environment (feature)",
"value": "marine bulk water ENVO:01000055",
"unit": null
},
{
"key": "environment (material)",
"value": "sea water ENVO:00002149",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "500",
"unit": "L"
},
{
"key": "ammonium",
"value": "3.09",
"unit": null
},
{
"key": "chlorophyll",
"value": "3.62",
"unit": null
},
{
"key": "depth",
"value": "1",
"unit": "m"
},
{
"key": "elevation",
"value": "0\r",
"unit": "m"
},
{
"key": "nitrate",
"value": "4.92",
"unit": null
},
{
"key": "nitrite",
"value": "0.36",
"unit": null
},
{
"key": "phosphate",
"value": "0.01",
"unit": null
},
{
"key": "salinity",
"value": "32.896",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "54.1917",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "20090414_bulkDNA_largeFraction",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Environmental > Aquatic > Marine > Unclassified > Uncharacterized",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS095016",
"analysis-completed": "2012-02-22",
"collection-date": "2009-04-14",
"geo-loc-name": "Germany, Heligoland, North Sea",
"sample-desc": "seawater was pumped into a 500 L carboy, brought ashore, subsequently filtered through 10 µm - and 3 µm - pore-size polycarbonate filters and finally filtered onto 0.2 µm pore-size polyethersulfone filter, frozen at -80°C",
"environment-biome": "neritic epipelagic zone biome ENVO:01000042",
"environment-feature": "marine bulk water ENVO:01000055",
"environment-material": "sea water ENVO:00002149",
"sample-name": "North Sea sample collected 14-APR-2009 (large fraction)",
"sample-alias": "20090414_bulkDNA_largeFraction",
"host-tax-id": null,
"species": null,
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Marine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Marine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS095016/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000298",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000298?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS095016/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS095016?format=api"
}
},
{
"type": "samples",
"id": "ERS095018",
"attributes": {
"latitude": 54.1917,
"longitude": 7.9,
"biosample": "SAMEA1318010",
"sample-metadata": [
{
"key": "silicate",
"value": "0.61",
"unit": null
},
{
"key": "temperature",
"value": "13.2",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "7.9",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Germany, Heligoland, North Sea",
"unit": null
},
{
"key": "collection date",
"value": "16-JUN-09",
"unit": null
},
{
"key": "environment (biome)",
"value": "neritic epipelagic zone biome ENVO:01000042",
"unit": null
},
{
"key": "environment (feature)",
"value": "marine bulk water ENVO:01000055",
"unit": null
},
{
"key": "environment (material)",
"value": "sea water ENVO:00002149",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "500",
"unit": "L"
},
{
"key": "ammonium",
"value": "0.97",
"unit": null
},
{
"key": "chlorophyll",
"value": "3.09",
"unit": null
},
{
"key": "depth",
"value": "1",
"unit": "m"
},
{
"key": "elevation",
"value": "0\r",
"unit": "m"
},
{
"key": "nitrate",
"value": "1.66",
"unit": null
},
{
"key": "nitrite",
"value": "0.14",
"unit": null
},
{
"key": "phosphate",
"value": "0.03",
"unit": null
},
{
"key": "salinity",
"value": "31.55",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "54.1917",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "20090616_bulkDNA",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Environmental > Aquatic > Marine > Unclassified > Uncharacterized",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS095018",
"analysis-completed": "2012-02-22",
"collection-date": "2009-06-16",
"geo-loc-name": "Germany, Heligoland, North Sea",
"sample-desc": "seawater was pumped into a 500 L carboy, brought ashore, subsequently filtered through 10 µm - and 3 µm - pore-size polycarbonate filters and finally filtered onto 0.2 µm pore-size polyethersulfone filter, frozen at -80°C",
"environment-biome": "neritic epipelagic zone biome ENVO:01000042",
"environment-feature": "marine bulk water ENVO:01000055",
"environment-material": "sea water ENVO:00002149",
"sample-name": "North Sea sample collected 16-JUN-2009",
"sample-alias": "20090616_bulkDNA",
"host-tax-id": null,
"species": null,
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Marine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Marine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS095018/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000298",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000298?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS095018/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS095018?format=api"
}
},
{
"type": "samples",
"id": "ERS095019",
"attributes": {
"latitude": 54.1917,
"longitude": 7.9,
"biosample": "SAMEA1318014",
"sample-metadata": [
{
"key": "silicate",
"value": "12.61",
"unit": null
},
{
"key": "temperature",
"value": "18",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "7.9",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Germany, Heligoland, North Sea",
"unit": null
},
{
"key": "collection date",
"value": "01-SEP-09",
"unit": null
},
{
"key": "environment (biome)",
"value": "neritic epipelagic zone biome ENVO:01000042",
"unit": null
},
{
"key": "environment (feature)",
"value": "marine bulk water ENVO:01000055",
"unit": null
},
{
"key": "environment (material)",
"value": "sea water ENVO:00002149",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "500",
"unit": "L"
},
{
"key": "ammonium",
"value": "0.8",
"unit": null
},
{
"key": "chlorophyll",
"value": "12.13",
"unit": null
},
{
"key": "depth",
"value": "1",
"unit": "m"
},
{
"key": "elevation",
"value": "0\r",
"unit": "m"
},
{
"key": "nitrate",
"value": "not measured",
"unit": null
},
{
"key": "nitrite",
"value": "0.07",
"unit": null
},
{
"key": "phosphate",
"value": "0.43",
"unit": null
},
{
"key": "salinity",
"value": "32.552",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "54.1917",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "20090901_bulkDNA",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Environmental > Aquatic > Marine > Unclassified > Uncharacterized",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS095019",
"analysis-completed": "2012-02-22",
"collection-date": "2009-09-01",
"geo-loc-name": "Germany, Heligoland, North Sea",
"sample-desc": "seawater was pumped into a 500 L carboy, brought ashore, subsequently filtered through 10 µm - and 3 µm - pore-size polycarbonate filters and finally filtered onto 0.2 µm pore-size polyethersulfone filter, frozen at -80°C",
"environment-biome": "neritic epipelagic zone biome ENVO:01000042",
"environment-feature": "marine bulk water ENVO:01000055",
"environment-material": "sea water ENVO:00002149",
"sample-name": "North Sea sample collected 01-SEP-2009",
"sample-alias": "20090901_bulkDNA",
"host-tax-id": null,
"species": null,
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Marine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Marine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS095019/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000298",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000298?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS095019/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS095019?format=api"
}
},
{
"type": "samples",
"id": "ERS153818",
"attributes": {
"latitude": 43.361,
"longitude": 5.3111,
"biosample": "SAMEA2128202",
"sample-metadata": [
{
"key": "sulfate",
"value": "2890\r",
"unit": "mg/l"
},
{
"key": "sulfide",
"value": "10\r",
"unit": "mg/l"
},
{
"key": "geographic location (longitude)",
"value": "5.31108\r",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "France, Mediterranean sea",
"unit": null
},
{
"key": "collection date",
"value": "01-MAR-2009\r",
"unit": null
},
{
"key": "environment (biome)",
"value": "ENVO:01000126 neritic sublittoral zone\r",
"unit": null
},
{
"key": "environment (feature)",
"value": "ENVO:00000464 harbor\r",
"unit": null
},
{
"key": "environment (material)",
"value": "ENVO:00002203 inorganically contaminated sediment\r",
"unit": null
},
{
"key": "depth",
"value": "2.5\r",
"unit": "m"
},
{
"key": "dissolved inorganic carbon",
"value": "142\r",
"unit": "mg/l"
},
{
"key": "dissolved organic carbon",
"value": "5.5\r",
"unit": "mg/l"
},
{
"key": "elevation",
"value": "-2.5\r",
"unit": "m"
},
{
"key": "pH",
"value": "7.5\r",
"unit": null
},
{
"key": "redox potential",
"value": "-75\r",
"unit": "mV"
},
{
"key": "geographic location (latitude)",
"value": "43.36095\r",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "GBSQMEQ01",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Environmental > Aquatic > Marine > Unclassified > Uncharacterized\r",
"unit": null
},
{
"key": "extreme_unusual_properties/Cu",
"value": "278\r",
"unit": "mg/kg"
},
{
"key": "extreme_unusual_properties/Cd",
"value": "0.3\r",
"unit": "mg/kg"
},
{
"key": "extreme_unusual_properties/Ni",
"value": "20\r",
"unit": "mg/kg"
},
{
"key": "extreme_unusual_properties/Zn",
"value": "375\r",
"unit": "mg/kg"
},
{
"key": "extreme_unusual_properties/Pb",
"value": "329\r",
"unit": "mg/kg"
},
{
"key": "extreme_unusual_properties/Mn",
"value": "161\r",
"unit": "mg/kg"
},
{
"key": "extreme_unusual_properties/Fe",
"value": "1.9\r",
"unit": "%"
},
{
"key": "extreme_unusual_properties/As",
"value": "165\r",
"unit": "mg/kg"
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS153818",
"analysis-completed": "2012-07-07",
"collection-date": "2009-03-01",
"geo-loc-name": "France, Mediterranean sea",
"sample-desc": "l'Estaque harbor sediment",
"environment-biome": "ENVO:01000126 neritic sublittoral zone",
"environment-feature": " ENVO:00000464 harbor",
"environment-material": "ENVO:00002203 inorganically contaminated sediment",
"sample-name": "l'Estaque harbor sediment metagenome",
"sample-alias": "GBSQMEQ01",
"host-tax-id": null,
"species": null,
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Marine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Marine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS153818/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000305",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000305?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS153818/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS153818?format=api"
}
},
{
"type": "samples",
"id": "ERS153819",
"attributes": {
"latitude": 43.079,
"longitude": 5.9241,
"biosample": "SAMEA2011062",
"sample-metadata": [
{
"key": "sulfate",
"value": "3070\r",
"unit": "mg/l"
},
{
"key": "sulfide",
"value": "below detection limit\r",
"unit": null
},
{
"key": "geographic location (longitude)",
"value": "5.92411\r",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "France, Mediterranean sea",
"unit": null
},
{
"key": "collection date",
"value": "01-MAR-2009\r",
"unit": null
},
{
"key": "environment (biome)",
"value": "ENVO:01000126 neritic sublittoral zone\r",
"unit": null
},
{
"key": "environment (feature)",
"value": "ENVO:00000464 harbor\r",
"unit": null
},
{
"key": "environment (material)",
"value": "ENVO:00002203 inorganically contaminated sediment\r",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": null,
"unit": null
},
{
"key": "depth",
"value": "4\r",
"unit": "m"
},
{
"key": "dissolved inorganic carbon",
"value": "61\r",
"unit": "mg/l"
},
{
"key": "dissolved organic carbon",
"value": "8.5\r",
"unit": "mg/l"
},
{
"key": "elevation",
"value": "-4\r",
"unit": "m"
},
{
"key": "pH",
"value": "7.7\r",
"unit": null
},
{
"key": "redox potential",
"value": "-76\r",
"unit": "mV"
},
{
"key": "geographic location (latitude)",
"value": "43.07895\r",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "GBSQMEQ02",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Environmental > Aquatic > Marine > Unclassified > Uncharacterized\r",
"unit": null
},
{
"key": "extreme_unusual_properties/Cu",
"value": "220\r",
"unit": "mg/kg"
},
{
"key": "extreme_unusual_properties/Cd",
"value": "<0.3\r",
"unit": "mg/kg"
},
{
"key": "extreme_unusual_properties/Ni",
"value": "15\r",
"unit": "mg/kg"
},
{
"key": "extreme_unusual_properties/Zn",
"value": "221\r",
"unit": "mg/kg"
},
{
"key": "extreme_unusual_properties/Pb",
"value": "110\r",
"unit": "mg/kg"
},
{
"key": "extreme_unusual_properties/Mn",
"value": "58\r",
"unit": "mg/kg"
},
{
"key": "extreme_unusual_properties/Fe",
"value": "1.6\r",
"unit": "%"
},
{
"key": "extreme_unusual_properties/As",
"value": "20\r",
"unit": "mg/kg"
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS153819",
"analysis-completed": "2012-07-07",
"collection-date": "2009-03-01",
"geo-loc-name": "France, Mediterranean sea",
"sample-desc": "St Mandrier harbor sediment",
"environment-biome": "ENVO:01000126 neritic sublittoral zone",
"environment-feature": " ENVO:00000464 harbor",
"environment-material": "ENVO:00002203 inorganically contaminated sediment",
"sample-name": "St Mandrier harbor sediment metagenome",
"sample-alias": "GBSQMEQ02",
"host-tax-id": null,
"species": null,
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Environmental:Aquatic:Marine"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Environmental:Aquatic:Marine?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS153819/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000305",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000305?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS153819/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS153819?format=api"
}
},
{
"type": "samples",
"id": "ERS155431",
"attributes": {
"latitude": null,
"longitude": null,
"biosample": "SAMEA2128203",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-80",
"unit": "°C"
},
{
"key": "sex",
"value": "female",
"unit": null
},
{
"key": "collection date",
"value": "15-JUN-2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "ENVO:00000446 terrestrial biome",
"unit": null
},
{
"key": "environment (feature)",
"value": "ENVO:00009003 human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "ENVO:00002003 feces",
"unit": null
},
{
"key": "sample collection device or method",
"value": "collection tube for faecal samples",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "1",
"unit": "g"
},
{
"key": "nucleic acid extraction",
"value": "Ausubel, F. M., Brent, R., Kinston, R., et al. 1992, Current protocol in molecular biology. ",
"unit": null
},
{
"key": "nucleic acid amplification",
"value": "none",
"unit": null
},
{
"key": "library size",
"value": "358",
"unit": null
},
{
"key": "library reads sequenced",
"value": "358",
"unit": null
},
{
"key": "library construction method",
"value": "Ligation of enzymatically digested DNA to pBluescript plasmid",
"unit": null
},
{
"key": "library vector",
"value": "pBluescript plasmid",
"unit": null
},
{
"key": "library screening strategy",
"value": "none",
"unit": null
},
{
"key": "sequencing method",
"value": "pyrosequencing",
"unit": null
},
{
"key": "age",
"value": "24",
"unit": "years"
},
{
"key": "body product",
"value": "stool",
"unit": null
},
{
"key": "body-mass index",
"value": "19.7",
"unit": null
},
{
"key": "diet",
"value": "mediterranean",
"unit": null
},
{
"key": "disease status",
"value": "none",
"unit": null
},
{
"key": "height",
"value": "167",
"unit": "cm"
},
{
"key": "host body temperature",
"value": "36.7",
"unit": "°C"
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "IHMC medication code",
"value": "none",
"unit": null
},
{
"key": "life stage",
"value": "adult",
"unit": null
},
{
"key": "sample storage duration",
"value": "1",
"unit": "week"
},
{
"key": "sample storage location",
"value": "freezer",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "Long insert human faecal clone library 1",
"unit": null
},
{
"key": "smoker",
"value": "Non-smoker",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS155431",
"analysis-completed": "2012-07-24",
"collection-date": "2011-06-15",
"geo-loc-name": null,
"sample-desc": "Human faecal sample",
"environment-biome": "ENVO:00000446 terrestrial biome",
"environment-feature": "ENVO:00009003 human-associated habitat",
"environment-material": "ENVO:00002003 feces",
"sample-name": "Long insert human faecal clone library 1",
"sample-alias": "Long insert human faecal clone library 1",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS155431/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000306",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000306?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS155431/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS155431?format=api"
}
},
{
"type": "samples",
"id": "ERS161373",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128220",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "3.01",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C1.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161373",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 1",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 1",
"sample-alias": " C1.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161373/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161373/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161373?format=api"
}
},
{
"type": "samples",
"id": "ERS161374",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128249",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "3.01",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C1.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161374",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 1 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 1 (amplicon)",
"sample-alias": " C1.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161374/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161374/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161374?format=api"
}
},
{
"type": "samples",
"id": "ERS161375",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128222",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "5.92",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C2.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161375",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 2",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 2",
"sample-alias": " C2.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161375/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161375/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161375?format=api"
}
},
{
"type": "samples",
"id": "ERS161376",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128205",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "5.92",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C2.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161376",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 2 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 2 (amplicon)",
"sample-alias": " C2.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161376/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161376/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161376?format=api"
}
},
{
"type": "samples",
"id": "ERS161377",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128239",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "22.95",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C3.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161377",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 3",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 3",
"sample-alias": " C3.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161377/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161377/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161377?format=api"
}
},
{
"type": "samples",
"id": "ERS161378",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128208",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "22.95",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C3.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161378",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 3 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 3 (amplicon)",
"sample-alias": " C3.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161378/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161378/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161378?format=api"
}
},
{
"type": "samples",
"id": "ERS161379",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128250",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "19.92",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C4.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161379",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 4",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 4",
"sample-alias": " C4.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161379/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161379/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161379?format=api"
}
},
{
"type": "samples",
"id": "ERS161380",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128211",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "19.92",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C4.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161380",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 4 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 4 (amplicon)",
"sample-alias": " C4.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161380/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161380/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161380?format=api"
}
},
{
"type": "samples",
"id": "ERS161381",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128243",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "23.55",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C5.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161381",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 5",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 5",
"sample-alias": " C5.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161381/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161381/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161381?format=api"
}
},
{
"type": "samples",
"id": "ERS161382",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128209",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "23.55",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C5.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161382",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 5 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 5 (amplicon)",
"sample-alias": " C5.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161382/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161382/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161382?format=api"
}
},
{
"type": "samples",
"id": "ERS161383",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128251",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "31.47",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C6.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161383",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 6",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 6",
"sample-alias": " C6.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161383/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161383/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161383?format=api"
}
},
{
"type": "samples",
"id": "ERS161384",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128219",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "31.47",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C6.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161384",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 6 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 6 (amplicon)",
"sample-alias": " C6.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161384/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161384/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161384?format=api"
}
},
{
"type": "samples",
"id": "ERS161385",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128245",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "10.29",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C7.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161385",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 7",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 7",
"sample-alias": " C7.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161385/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161385/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161385?format=api"
}
},
{
"type": "samples",
"id": "ERS161386",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128223",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "10.29",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C7.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161386",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 7 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 7 (amplicon)",
"sample-alias": " C7.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161386/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161386/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161386?format=api"
}
},
{
"type": "samples",
"id": "ERS161387",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128204",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "24.75",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C8.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161387",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 8",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 8",
"sample-alias": " C8.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161387/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161387/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161387?format=api"
}
},
{
"type": "samples",
"id": "ERS161388",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128244",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "24.75",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CCATCTCATCCCTGCGTGTCTCCGACTCAG, CCTATCCCCTGTGTGCCTTGGCAGTC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C8.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161388",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 8 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 8 (amplicon)",
"sample-alias": " C8.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161388/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161388/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161388?format=api"
}
},
{
"type": "samples",
"id": "ERS161389",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128218",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "5.77",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C9.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161389",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 9",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 9",
"sample-alias": " C9.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161389/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161389/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161389?format=api"
}
},
{
"type": "samples",
"id": "ERS161390",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128215",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "5.77",
"unit": "g"
},
{
"key": "pcr primers",
"value": "forward E8F: 5' AGAGTTTGATCMTGGCTCAG 3'; reverse B530R: 5' TCAGCCGCGGCKGCTGGCAC 3'",
"unit": null
},
{
"key": "adapters",
"value": "CGTATCGCCTCCCTCGCGCCA, CTATGCGCCTTGCCAGCCCGC",
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C9.b",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161390",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 9 (amplicon)",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 9 (amplicon)",
"sample-alias": " C9.b",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161390/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161390/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161390?format=api"
}
},
{
"type": "samples",
"id": "ERS161391",
"attributes": {
"latitude": 39.4767,
"longitude": -0.3744,
"biosample": "SAMEA2128217",
"sample-metadata": [
{
"key": "sample storage temperature",
"value": "-70",
"unit": "°C"
},
{
"key": "geographic location (longitude)",
"value": "-0.374444444",
"unit": null
},
{
"key": "geographic location (country and/or sea,region)",
"value": "Spain; Valencia",
"unit": null
},
{
"key": "collection date",
"value": "July 2011",
"unit": null
},
{
"key": "environment (biome)",
"value": "terrestrial biome ENVO:00000446",
"unit": null
},
{
"key": "environment (feature)",
"value": "human-associated habitat",
"unit": null
},
{
"key": "environment (material)",
"value": "feces",
"unit": null
},
{
"key": "amount or size of sample collected",
"value": "25.38",
"unit": "g"
},
{
"key": "pcr primers",
"value": null,
"unit": null
},
{
"key": "adapters",
"value": null,
"unit": null
},
{
"key": "disease status",
"value": "id: DOID:8778 Crohn's disease",
"unit": null
},
{
"key": "host common name",
"value": "Homo sapiens",
"unit": null
},
{
"key": "host taxid",
"value": "9606",
"unit": null
},
{
"key": "phenotype",
"value": "Crohns disease",
"unit": null
},
{
"key": "geographic location (latitude)",
"value": "39.47666667",
"unit": null
},
{
"key": "alt id - submitted sample id",
"value": "C10.v",
"unit": null
},
{
"key": "body habitat",
"value": "gut",
"unit": null
},
{
"key": "storage conditions (fresh/frozen/other)",
"value": "Frozen",
"unit": null
},
{
"key": "GOLD sample classification",
"value": "Host-associated > Human > Digestive system > Large intestine > Fecal",
"unit": null
},
{
"key": "NCBI sample classification",
"value": "408170",
"unit": null
},
{
"key": "instrument model",
"value": "454 GS FLX Titanium",
"unit": null
}
],
"accession": "ERS161391",
"analysis-completed": "2013-07-25",
"collection-date": "2011-07-01",
"geo-loc-name": "Spain; Valencia",
"sample-desc": "Fecal sample from Crohn's patient 10",
"environment-biome": "terrestrial biome ENVO:00000446",
"environment-feature": "human-associated habitat",
"environment-material": "feces",
"sample-name": "Fecal sample from Crohn's patient 10",
"sample-alias": " C10.v",
"host-tax-id": 9606,
"species": "Homo sapiens",
"last-update": "2015-08-13T15:30:55"
},
"relationships": {
"biome": {
"data": {
"type": "biomes",
"id": "root:Host-associated:Human:Digestive system:Large intestine:Fecal"
},
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/biomes/root:Host-associated:Human:Digestive%20system:Large%20intestine:Fecal?format=api"
}
},
"studies": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161391/studies?format=api"
},
"data": [
{
"type": "studies",
"id": "MGYS00000307",
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/studies/MGYS00000307?format=api"
}
}
]
},
"runs": {
"links": {
"related": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161391/runs?format=api"
}
}
},
"links": {
"self": "https://www.ebi.ac.uk/metagenomics/api/v1/samples/ERS161391?format=api"
}
}
],
"meta": {
"pagination": {
"page": 17420,
"pages": 17433,
"count": 435812
}
}
}