Please note that we have stopped the regular imports of Gene Expression Omnibus (GEO) data into ArrayExpress. This may not be the latest version of this experiment.

E-GEOD-60003 - Expression data from Control or ShSuz12 rat Intestinal epithelial cells IEC-6

Status
Released on 2 August 2014, last updated on 9 August 2014
Organism
Rattus norvegicus
Samples (6)
Array (1)
Protocols (7)
Description
Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial cell (IEC) phenotype is not known. We investigated the impact of Suz 12 depletion on gene expression in IEC-6 cells. Multiple shRNA lentiviral constructs were tested in IEC-6 cells for their ability to down-regulate Suz12 expression (MISSION shRNA lentiviral transduction particles, Sigma–Aldrich Canada, Oakville, ON). Forty percent confluent cells were infected in medium supplemented with 4 mg/ml polybrene (Sigma–Aldrich Canada) for 6 h. Two days after infection, cell populations were selected with 2 mg/ml puromycin (Sigma–Aldrich Canada). The clone TRCN0000038728 was selected: the shRNA against Suz12 (GCTGACAATCAAATGAATCAT) is conserved in rat (accession number FM084383), murine (accession number NM_199196) and human (accession number NM_015355.2) Suz12 sequences. Efficiency of infection was estimated at 25%. Control or ShSuz12 IEC-6 cell total RNAs were isolated with the Rneasy kit (Qiagen, Mississauga, ON, Canada), according to the manufacturer’s instructions. RNA samples from three independent experiments were used for microarray analysis.
Experiment type
transcription profiling by array 
Contacts
Claude Asselin <claude.asselin@usherbrooke.ca>, Jean-François Delabre, Mylene Blais, Naomie Turgeon
Citation
MIAME
PlatformsProtocolsVariablesProcessedRaw
Files
Investigation descriptionE-GEOD-60003.idf.txt
Sample and data relationshipE-GEOD-60003.sdrf.txt
Raw data (1)E-GEOD-60003.raw.1.zip
Processed data (1)E-GEOD-60003.processed.1.zip
Array designA-AFFY-43.adf.txt
Links