Please note that we have stopped the regular imports of Gene Expression Omnibus (GEO) data into ArrayExpress. This may not be the latest version of this experiment.

E-GEOD-38171 - Synergistic activation by p38MAPK and glucocorticoid signaling mediates induction of M2-like tumor-associated macrophages expressing the novel CD20 homolog MS4A8A

Status
Released on 22 May 2012, last updated on 31 May 2012
Organism
Mus musculus
Samples (6)
Array (1)
Protocols (8)
Description
Tumor-associated macrophages (TAMs) represent alternatively activated (M2) macrophages that support tumor growth. Previously, we have described a special LYVE-1(+) M2 TAM subset in vitro and in vivo; gene profiling of this TAM subset identified MS4A8A as a novel TAM molecule expressed in vivo by TAM in mammary carcinoma and malignant melanoma. In vitro, Ms4a8a mRNA and MS4A8A protein expression was strongly induced in bone marrow-derived macrophages (BMDMs) by combining M2 mediators (IL-4, glucocorticoids) and tumor-conditioned media (TCM). Admixture of MS4A8A(+) TCM/IL-4/GC-treated BMDM significantly enhanced the tumor growth rate of subcutaneously transplanted TS/A mammary carcinomas. Upon forced overexpression of MS4A8A, Raw 264.7 macrophage-like cells displayed a special gene signature. Admixture of these MS4A8A(+) Raw 264.7 cells also significantly enhanced the tumor growth rate of subcutaneously transplanted mammary carcinomas. To identify the signaling pathways involved in synergistic induction of MS4A8A, the major signaling cascades with known functions in TAM were analyzed. Although inhibitors of NF-κB activation and of the MAPK JNK and ERK did not show relevant effects, the p38α/β MAPK inhibitor SB203580 strongly and highly significantly (p > 0.001) inhibited MS4A8A expression on mRNA and protein level. In addition, MS4A8A expression was restricted in M2 BMDM from mice with defective GC receptor (GR) dimerization indicating that classical GR gene regulation is mandatory for MS4A8A induction. In conclusion, expression of MS4A8A within the complex signal integration during macrophage immune responses may act to fine tune gene regulation. Furthermore, MS4A8A(+) TAM may serve as a novel cellular target for selective cancer therapy. A recombinant Ms4a8a cDNA was amplified by PCR (primer: Ms4a8a-SpeI-fw 5’ATCGAATTCACTAGTAGCAAAGAGTTGGGAACCGGAGCAAGA3’ and Ms4a8a-NotI-rv: 5’ATATGCGGCCGCTAGAGCATCTTTAT3’) from Ms4a8a cDNA RZPDp981B0530D (IMAGE ID 905005), purified on agarose gel and subcloned after digestion with SpeI and NotI restriction enzymes into the expression vector pEF6/V5-His Topo (Invitrogen) according to standard molecular biology protocols. After confirming sequence identity, we transfected RAW264.7 cells with Ms4a8a vector DNA using Lipofectamine 2000 (Invitrogen) transfection reagent. Transfectants were selected by resistance to blasticidin (Invitrogen). Raw264.7Ms4a8a clone K8 with recombinant Ms4a4a expression were propagated. As a negative control, a vector-transfected RAW264.7mock (clone K3) was selected under parallel culture conditions.
Experiment type
transcription profiling by array 
Contacts
Carsten Sticht <geo@ncbi.nlm.nih.gov>, Astrid Schmieder, Kai Schledzewski
Citation
Synergistic activation by p38MAPK and glucocorticoid signaling mediates induction of M2-like tumor-associated macrophages expressing the novel CD20 homolog MS4A8A. Schmieder A, Schledzewski K, Michel J, Tuckermann JP, Tome L, Sticht C, Gkaniatsou C, Nicolay JP, Demory A, Faulhaber J, Kzhyshkowska J, Géraud C, Goerdt S. , PMID:20824698
MIAME
PlatformsProtocolsVariablesProcessedRaw
Files
Investigation descriptionE-GEOD-38171.idf.txt
Sample and data relationshipE-GEOD-38171.sdrf.txt
Raw data (1)E-GEOD-38171.raw.1.zip
Processed data (1)E-GEOD-38171.processed.1.zip
Array designA-GEOD-15041.adf.txt
Links