
ID   GU376469; SV 1; linear; genomic DNA; STD; HUM; 4336 BP.
AC   GU376469;
DT   23-FEB-2010 (Rel. 103, Created)
DT   12-DEC-2012 (Rel. 115, Last updated, Version 2)
DE   Homo sapiens MHC class I antigen (HLA-Cw) gene, HLA-Cw*0130 allele,
DE   promoter region and complete cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-4336
RX   DOI; 10.1016/j.humimm.2010.03.001.
RX   PUBMED; 20226825.
RA   Deng Z., Wang D., Xu Y., Gao S., Zhou H., Yu Q., Yang B.;
RT   "HLA-C polymorphisms and PCR dropout in exons 2 and 3 of the Cw*0706 allele
RT   in sequence-based typing for unrelated Chinese marrow donors";
RL   Hum. Immunol. 71(6):577-581(2010).
RN   [2]
RP   1-4336
RA   Xu Y.P., Deng Z.H., Yang B.C.;
RT   ;
RL   Submitted (02-JAN-2010) to the INSDC.
RL   Immunogenetic Laboratory, Shenzhen Blood Center, 2 Meigang West Street,
RL   Nigang West Road, Shenzhen, Guangdong 518035, China
DR   MD5; 6175b9317288125a1aa7c44efac60a73.
FH   Key             Location/Qualifiers
FT   source          1..4336
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.3"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: tggactcacacarggaaactc, rev_seq:
FT                   gggacaaggacaatggagcag"
FT                   /db_xref="taxon:9606"
FT   gene            <1..4336
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*0130"
FT   regulatory      <1..6
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*0130"
FT                   /regulatory_class="promoter"
FT   mRNA            join(7..932,1063..1332,1579..1854,2442..2717,2839..2958,
FT                   3398..3430,3538..3585,3750..4336)
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*0130"
FT                   /product="MHC class I antigen"
FT   5'UTR           7..859
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*0130"
FT   CDS             join(860..932,1063..1332,1579..1854,2442..2717,2839..2958,
FT                   3398..3430,3538..3585,3750..3754)
FT                   /codon_start=1
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*0130"
FT                   /product="MHC class I antigen"
FT                   /note="glycoprotein"
FT                   /db_xref="GOA:D3XQC2"
FT                   /db_xref="IMGT/HLA:C*01:30"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR010579"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:D3XQC2"
FT                   /protein_id="ADC79685.1"
FT   3'UTR           3755..4336
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*0130"
SQ   Sequence 4336 BP; 878 A; 1187 C; 1301 G; 970 T; 0 other;
     gggctagaga atgaggataa ttttaaatgc aacaacccag agtcacagat ccatagtctg        60
     cgaaagtaaa acaggaggtt tgagaattta attgtaatgc agttttgaca caggtctttc       120
     acagattgga attctaatca ttcagggatt accaatattg tgctacctac tgtatcaata       180
     aacaaaaagg aaactggtct ctatgagaat ctctacctgg tgctttcaga caacacttca       240
     ccaggtttaa agagaaaact cctgactcta cacgtccatt cccagggcga gctcactgtc       300
     tggcatcaag ttccccatgg tgagtttccc tgtacaagag tccaagggga gaggtaagtg       360
     tcctttattt tgctggatgt agtttaatat tacctgaggt aaggtaaggc aaagagtggg       420
     aggcagggag tccagttcag ggacggggat tccaggagaa gtgaagggga aggggctggg       480
     cgcagcctgg gggtctctcc ctggtttcca cagacagatc cttggccagg actcaggcac       540
     acagtgtgac aaagatgctt ggtgtaggag aagagggatc aggacgaagt cccaggtccc       600
     gggcggggtt ctcagggtct caggctccaa gggccgtgtc tgcactgggg aggcgccgcg       660
     ttgaggattc tccactcccc tgagtttcac ttcttctccc aacctgcgtc gggtccttct       720
     tcctgaatac tcatgacgcg tccccaattc ccactcccat tgggtgtcgg gttctagaga       780
     agccaatcag cgtctccgca gtcccggttc taaagtcccc agtcacccac ccggactcag       840
     attctcccca gacgccgaga tgcgggtcat ggcgccccga accctcatcc tgctgctctc       900
     gggagccctg gccctgaccg agacctgggc ctgtgagtgc ggggttggga gggaaacggc       960
     ctctgcggag aggaacgagg tgcccgcccg gcgagggcgc aggacccggg gagccgcgca      1020
     gggaggaggg tcgggcgggt ctcagcccct cctcgccccc aggctcccac tccatgaagt      1080
     atttcttcac atccgtgtcc cggcctggcc gcggagagcc ccgcttcatc tcagtgggct      1140
     acgtggacga cacgcagttc gtgcggttcg acagcgacgc cgcgagtccg agaggggagc      1200
     cgcgggcgcc gtgggtggag caggaggggc cggagtattg ggaccgggag acacagaagt      1260
     acaagcgcca ggcacagact gaccgagtga gcctgcggaa cctgcgcggc tactacaacc      1320
     agagcgaggc cggtgagtga ccccggcccg gggcgcaggt cacgacccct cctcatcccc      1380
     cacggacggc ccgggtcgcc ccaagtctcc cggtctgaga tccaccccga ggctgcggaa      1440
     cccgcccaga ccctcgaccg gagagagccc cagtcacctt tacccggttt cattttcagt      1500
     ttaggccaaa atccccgcgg gttggtcggg actggggcgg ggctcggggg acggggctga      1560
     ccacgggggc ggggccaggg tctcacaccc tccagtggat gtgtggctgc gacctggggc      1620
     ccgacgggcg cctcctccgc gggtatgacc agtacgccta cgacggcaag gattacatcg      1680
     ccctgaacga ggacctgcgc tcctggaccg ccgcggacac cgcggctcag atcacccagc      1740
     gcaagtggga ggcggcccgt gaggcggagc agcggagagc ctacctggag ggcacgtgcg      1800
     tggagtggct ccgcagacac ctggagaacg ggaaggagac gctgcagcgc gcgggtacca      1860
     ggggcagtgg ggagccttcc ccatctcccg tagatctccc ggcatggcct cccacgagga      1920
     ggggaggaaa atgggatcag cgctagaata tcgccctccc ttgaatggag aatgggatga      1980
     gttttcctga gtttcctctg agggccccct ctgctctcta ggacaattaa gggatgaagt      2040
     ccttgaggaa atggagggga agacagtccc tggaatactg atcaggggtc ccctttgacc      2100
     actttgacca ctgcagcagc tgtggtcagg ctgctgacct ttctctcagg ccttgttctc      2160
     tgcctcacgc tcaatgtgtt tgaaggtttg attccagctt ttctgagtcc ttcggcctcc      2220
     actcaggtca ggaccagaag tcgctgttcc tccctcagag actagaactt tccaatgaat      2280
     aggagattat cccaggtgcc tgtgtccagg ctggcgtctg ggttctgtgc ccccttcccc      2340
     accccaggtg tcctgtccat tctcaggatg gtcacatggg cgctgttgga gtgtcgcaag      2400
     agagatacaa agtgtctgaa ttttctgact cttcccgtca gaacacccaa agacacacgt      2460
     gacccaccat cccgtctctg accatgaggc caccctgagg tgctgggccc tgggcttcta      2520
     ccctgcggag atcacactga cctggcagtg ggatggggag gaccaaactc aggacaccga      2580
     gcttgtggag accaggccag caggagatgg aaccttccag aagtgggcag ctgtgatggt      2640
     gccttctgga gaagagcaga gatacacgtg ccatgtgcag cacgaggggc tgccggagcc      2700
     cctcaccctg agatggggta aggaggggga tgaggggtga tgtgtcttct cagggaaagc      2760
     agaagtcctg gagcccttca gccgggtcag ggctgaggct tggaggtcag ggcccctcac      2820
     cttcccctcc tttcccagag ccgtcttccc agcccaccat ccccatcgtg ggcatcgttg      2880
     ctggcctggc tgtcctggct gtcctagctg tcctaggagc tgtggtggct gttgtgatgt      2940
     gtaggaggaa gagctcaggt agggaagggg tgaggagtgg ggtctgggtt ttcttgttcc      3000
     actgggagtt tcaagcccca ggtagaagtg tgccccacct cgttactgga agcaccatcc      3060
     acacatgggc catcccagcc tgggaccctg tgtgccagca cttactctgt tgtgaagcac      3120
     atgacaatga aggacagatg tatcaccttg atgattatgg tgttggggtc cttgattcca      3180
     gcattcatga gtcaggggaa ggtccctgct aaggacagac cttaggaggg cagttgcttc      3240
     agaacccaca gctgctttcc ccgtgtttcc tgatcctgcc ctgggtctgc agtcatagtt      3300
     ctggaaactt ctcttgggtc caagactagg aggttcccct aagatcgcat ggccctgcct      3360
     cctccctgtc ccctcacagg gcattttctt cccacaggtg gaaaaggagg gagctgctct      3420
     caggctgcgt gtaagtgatg gcggtgggcg tgtggaggag ctcacccacc ccataattcc      3480
     tcttgtccca catctcctgc gggctctgac caggtctttt tttttgttct accccagcca      3540
     gcaacagtgc ccagggctct gatgagtctc tcatcgcttg taaaggtgag attctgggga      3600
     gctgaagtgg tcgggggtgg ggcagaggga aaaggcctag gtaatgggga tcctttgatt      3660
     gggacgtttc gaatgtgtgg tgagctgttc agagtgtcat cacttaccat gactgacctg      3720
     aatttgttca tgactattgt gttctgtagc ctgagacagc tgcctgtgtg ggactgagat      3780
     gcaggatttc ttcacacctc tcctttgtga cttcaagagc ctctggcatc tctttctgca      3840
     aaggcatctg aatgtgtctg cgttcctgtt agcataatgt gaggaggtgg agagacagcc      3900
     cacccccgtg tccaccgtga cccctgtccc cacactgacc tgtgttccct ccccgatcat      3960
     ctttcctgtt ccagagaagt gggctggatg tctccatctc tgtctcaact tcatggtgcg      4020
     ctgagctgca acttcttact tccctaatga agttaagaac ctgaatataa atttgttttc      4080
     tcaaatattt gctatgaagg gttgatggat taattaaata agtcaattcc tggaagttga      4140
     gagagcaaat aaagacctga gaaccttcca gaatccgcat gttcgctgtg ctgagtctgt      4200
     tgcaggtggg ggtggggaag gctgtgagga gacgagtgtg gacggggcct gtgcctagtt      4260
     gctgttcagt tcttcatggg ctttatgtgg tcagtcctca gctgggtcac cttcactgct      4320
     ccattgtcct tgtccc                                                      4336