- Course overview
- Search within this course
- What is antimicrobial resistance?
- How do we study pathogens?
- Public pathogen data
- A guide to the Pathogens Portal
- Analysing genomic data from pathogens
- Identification and investigation of antimicrobial resistance genes
- Data sharing
- The future of AMR
- Crossword: Test your knowledge
- Your feedback
- Further resources
- Help and support
- Glossary
- References
All materials are free cultural works licensed under a Creative Commons Attribution 4.0 International (CC BY 4.0) license, except where further licensing details are provided.
Mission 1: Gene detective
MGnify has generated genome catalogues which are curated collections of biome-specific metagenomic assembled genomes (MAGs) and isolate genomes. Using the ‘Gene search’ function you can search for specific DNA sequences across the catalogues, and access information about the environment and organism the sequence was found in.
Below is the DNA sequence for the gene AAC(6′)-Ib-cr1, which is found in the genome of Klebsiella pneumoniae ST307 (GCA_001566595.1). AAC(6′)-Ib-cr1 is an aminoglycoside acetyltransferase enzyme which provides resistance against aminoglycoside antibiotics via drug inactivation.
ATGAGCAACGCAAAAACAAAGTTAGGCATCACAAAGTACAGCATCGTGACCAACAGCAACGATTCCGTCACACTGCGCCTCATGACTGAGCATGACCTTGCGATGCTCTATGAGTGGCTAAATCGATCTCATATCGTCGAGTGGTGGGGCGGAGAAGAAGCACGCCCGACACTTGCTGACGTACAGGAACAGTACTTGCCAAGCGTTTTAGCGCAAGAGTCCGTCACTCCATACATTGCAATGCTGAATGGAGAGCCGATTGGGTATGCCCAGTCGTACGTTGCTCTTGGAAGCGGGGACGGACGGTGGGAAGAAGAAACCGATCCAGGAGTACGCGGAATAGACCAGTTACTGGCGAATGCATCACAACTGGGCAAAGGCTTGGGAACCAAGCTGGTTCGAGCTCTGGTTGAGTTGCTGTTCAATGATCCCGAGGTCACCAAGATCCAAACGGACCCGTCGCCGAGCAACTTGCGAGCGATCCGATGCTACGAGAAAGCGGGGTTTGAGAGGCAAGGTACCGTAACCACCCCATATGGTCCAGCCGTGTACATGGTTCAAACACGCCAGGCATTCGAGCGAACACGCAGTGATGCCTAA
Copy the sequence and paste it into the gene search box, then press the search button. Explore the results and have a go at answering the questions below!