RNAcentral identifiers

One of the goals of RNAcentral is to assign unique and stable identifiers to all ncRNA sequences, which may simplify many tasks, such as referring to an RNA sequence in a paper or comparing two sets of sequences.

RNAcentral identifiers

barcode iconRNAcentral identifiers are like barcodes that uniquely identify each RNA sequence. Each distinct sequence is assigned an Unique RNAcentral Sequence identifier (URS) regardless of what species the sequence is from.
RNAcentral identifiers have the following format: URS + 10-digit hexadecimal number

For example, sequence AACCCGUAGAUCCGAACUUGUG has been assigned the following identifier: URS000040D674. All Expert Databases that annotate this sequence will be linked to this identifier.

info iconThis format can accommodate more than 1 trillion sequences. At the time of writing about 8.6 million identifiers have been assigned.