Step 1 - Use BLAST/BLAT

NotesUse this sequence to enter the browser.
CTCCGCACTGCTCACTCCCGCGCAGTGAGGTTGGCACAGCCACCGCTCTGT
GGCTCGCTTGGTTCCCTTAGTCCCGAGCGCTCGCCCACTGCAGATTCCTTT
CCCGTGCAGACATGGCCT

Figure 50. Paste the sequence into the BLAST interface.

Steps

  1. Start at the Ensembl home page.
  2. Click on BLAST/BLAT at the top of the page (Figure 50).
  3. Enter the sequence at the top of the BLAST/BLAT view.
  4. Make sure your species of interest is chosen (Homo sapiens).
  5. Click RUN. The default program is BLASTN, against Genomic sequence.