|
Figure 1.
Fig. 1. Size-exclusion chromatography and limited proteolysis
of MxiC. a, Elution of MxiC[FL] (continuous line) and
MxiC[NΔ73] (broken line) from a HiLoad 16/60 Superdex 200
column pre-equilibrated in 20 mM Tris (pH 7.5), 150 mM NaCl.
MxiC[FL] and MxiC[NΔ73] elute as monomers as single, slightly
asymmetric peaks. b, SDS-PAGE of limited proteolysis of
MxiC[FL]. Degradation of purified MxiC[FL] was considerable
after storage at 4 °C for eight weeks (lane 1). Limited
proteolysis was carried out on freshly purified MxiC[FL]
incubated for 2 h at 20 °C with an increasing mass ratio of
protein:subtilisin from 20 μg:2 ng to 20 μg:80 ng (lanes
2–6). Methods: DNA fragments of the mxiC gene encoding
residues 1–355 (full length, MxiC[FL]) and 74–355
(N-terminal truncation, MxiC[NΔ73]) were produced by PCR (FLf,
CATATGCTTGATGTTAAAAATACAGGAGTTTTT; N73f,
CATATGAGTCAGGAACGTATTTTAGAT; FLr,
GAATTCTTATCTAGAAAGCTCTTTCTTGTATGCACT) and cloned into the
NdeI-EcoRI sites of the pET28b vector. These constructs include
an N-terminal His[6]-tag and a thrombin cleavage site. MxiC
constructs were expressed in Escherichia coli BL21 (DE3) cells
grown in LB medium containing 34 μg ml^− 1 kanamycin. Cells
were grown at 37 °C until an A[600] nm of  vert,
similar 0.6 was reached, whereupon they were cooled to 20 °C
and protein over-expression was induced by the addition of IPTG
(1.0 mM final concentration). After vert,
similar 16 h, cells were harvested by centrifugation (15 min,
5000g, 4 °C) and pellets were frozen at – 80 °C. Cell
pellets were resuspended in lysis buffer (20 mM Tris (pH 7.5),
500 mM NaCl and Complete EDTA-free Protease Inhibitor Cocktail,
Roche) and lysed using an Emulsiflex-C5 Homogeniser (Glen
Creston, UK). The resultant cell suspension was centrifuged (20
min, 20,000g, 4 °C) and the soluble fraction was applied to
a pre-charged HisTrap FF nickel affinity column (GE Life
Sciences). Protein was eluted using a gradient of 0–1 M
imidazole in 20 mM Tris (pH 7.5), 500 mM NaCl and fractions
containing MxiC were further purified by size-exclusion
chromatography as described above. SDS-PAGE analysis revealed
MxiC[FL] and MxiC[NΔ73] to be pure (data not shown). Fractions
containing purified MxiC were pooled and concentrated using
Millipore Ultra-15 10 k MWCO centrifugal filtration devices to 7
mg ml^− 1 and stored at 4 °C. Selenomethionine
(SeMet)-labeled MxiC was produced by expression in the E.coli
met^− auxotrophic strain B834 (DE3). Cultures were grown in LB
medium to an A[600 nm] of 0.9 then pelleted (15 min, 4000g, 4
°C) and washed in PBS three times before being used to
inoculate SelenoMet Medium Base™ containing SelenoMet Nutrient
Mix™ (Molecular Dimensions). Cells were grown and induced as
described above. SeMet-labeled protein was purified as described
above. Full incorporation of selenomethionine was confirmed by
mass spectrometry. Dynamic light-scattering experiments were
performed on a Viscotek model 802 DLS instrument using the
OmniSIZE 2.0 acquisition and control software according to the
manufacturer's instructions at 20 °C on a 1 mg ml^− 1
protein sample in 20 mM Tris (pH 7.5), 150 mM NaCl.
|
