PDBsum entry 5e3o

DNA binding protein/DNA

PDB id: 5e3o

Contents

Protein chains

91 a.a.

98 a.a.

DNA/RNA

Waters ×8

PDB id:

5e3o

Name:

DNA binding protein/DNA

Title:

Crystal structure of fis bound to 27bp DNA f32 (aaatttggaggaattttctccaaattt)

Structure:

DNA-binding protein fis. Chain: a, b. Synonym: factor-for-inversion stimulation protein,hin recombinational enhancer-binding protein. Engineered: yes. DNA (27-mer). Chain: c. Engineered: yes. DNA (27-mer).

Source:

Escherichia coli. Organism_taxid: 83333. Strain: k12. Gene: fis, b3261, jw3229. Expressed in: escherichia coli. Expression_system_taxid: 469008. Synthetic: yes. Synthetic construct. Organism_taxid: 32630.

Resolution:

2.78Å R-factor: 0.222 R-free: 0.267

Authors:

S.P.Hancock,D.Cascio,R.C.Johnson

Key ref:

S.P.Hancock et al. (2016). DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, e0150189. PubMed id: 26959646 DOI: 10.1371/journal.pone.0150189

Date:

03-Oct-15 Release date: 09-Mar-16

Protein chain

P0A6R3  (FIS_ECOLI) -  DNA-binding protein Fis from Escherichia coli (strain K12)

Seq: 98 a.a.

Struc: 91 a.a.

Protein chain

P0A6R3  (FIS_ECOLI) -  DNA-binding protein Fis from Escherichia coli (strain K12)

Seq: 98 a.a.

Struc: 98 a.a.

DNA/RNA chains

A-A-A-T-T-T-G-G-A-G-G-A-A-T-T-T-T-C-T-C-C-A-A-A-T-T-T 27 bases

A-A-A-T-T-T-G-G-A-G-A-A-A-A-T-T-C-C-T-C-C-A-A-A-T-T-T 27 bases

Enzyme reactions

• Enzyme class: Chains A, B: E.C.?

DOI no: 10.1371/journal.pone.0150189

Plos One 11:e0150189 (2016)

PubMed id: 26959646

DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.

S.P.Hancock, S.Stella, D.Cascio, R.C.Johnson.

ABSTRACT

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequences in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. The affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.