PDBsum entry 2kuu

RNA

PDB id: 2kuu

Contents

DNA/RNA

PDB id:

2kuu

Name:

RNA

Title:

Solution structure of k10 tls RNA (gc mutant in upper helix)

Structure:

K10 tls RNA. Chain: a. Engineered: yes. Mutation: yes. Other_details: the wild-type sequence of k10 tls RNA is 'ggcuugauuguauuuuuaaauuaauucuuaaaaacuacaaauuaagcc'. The mutation in the gc mutant in upper helix RNA are: u14g, u16g, a31c, a33c.

Source:

Synthetic: yes. Drosophila melanogaster. Fruit fly. Organism_taxid: 7227. Other_details: prepared by in vitro transcription using t7 RNA polymerase

NMR struc:

12 models

Authors:

S.L.Bullock,I.Ringel,D.Ish-Horowicz,P.J.Lukavsky

Key ref:

S.L.Bullock et al. (2010). A'-form RNA helices are required for cytoplasmic mRNA transport in Drosophila. Nat Struct Biol, 17, 703-709. PubMed id: 20473315

Date:

01-Mar-10 Release date: 19-May-10

DNA/RNA chain

G-G-C-U-U-G-A-U-U-G-U-A-U-G-U-G-U-A-A-A-U-U-A-A-U-U-C-U-U-A-C-A-C-A-C-U-A-C-A- 48 bases

Nat Struct Biol 17:703-709 (2010)

PubMed id: 20473315

A'-form RNA helices are required for cytoplasmic mRNA transport in Drosophila.

S.L.Bullock, I.Ringel, D.Ish-Horowicz, P.J.Lukavsky.

ABSTRACT

Microtubule-based mRNA transport is widely used to restrict protein expression to specific regions in the cell and has important roles in defining cell polarity and axis determination as well as in neuronal function. However, the structural basis of recognition of cis-acting mRNA localization signals by motor complexes is poorly understood. We have used NMR spectroscopy to describe the first tertiary structure to our knowledge of an RNA element responsible for mRNA transport. The Drosophila melanogaster fs(1)K10 signal, which mediates transport by the dynein motor, forms a stem loop with two double-stranded RNA helices adopting an unusual A'-form conformation with widened major grooves reminiscent of those in B-form DNA. Structure determination of four mutant RNAs and extensive functional assays in Drosophila embryos indicate that the two spatially registered A'-form helices represent critical recognition sites for the transport machinery. Our study provides insights into the basis for RNA cargo recognition and reveals a key biological function encoded by A'-form RNA conformation.