RNA chain C

tRNA-like structure from brome mosaic virus RNA 3.

Source organism: Brome mosaic virus [12302]
Expression system: Not provided
As chain: C
Length: 171 nucleotides
Theoretical weight: 55.04 KDa
FASTA Sequence
>pdb|7scq|C
GGCGUGGUUGACACGCAGACCUCUUACAAGAGUGUCUAGGUGCCUUUGAGAGUUACUCUUUGCUCUCUUCGGAAGAACCCUUAGGGGUUCGUGCAUGGGCUUGCAUAGCAAGUCUUAGAAUGCGGGUACCGUACAGUGUUGAAAAACACUGUAAAUCUCUAAAAGAGACCA

Visualisation