RNA chain C

tRNA-like structure from brome mosaic virus RNA 3

Source organism: Brome mosaic virus [12302]
Expression system: Not provided
As chain: C
Length: 171 nucleotides
Theoretical weight: 55.04 KDa
Rfam:
  • Pseudoknot of tRNA-like structure (RF01084 )
FASTA Sequence
>pdb|7sc6|C
GGCGUGGUUGACACGCAGACCUCUUACAAGAGUGUCUAGGUGCCUUUGAGAGUUACUCUUUGCUCUCUUCGGAAGAACCCUUAGGGGUUCGUGCAUGGGCUUGCAUAGCAAGUCUUAGAAUGCGGGUACCGUACAGUGUUGAAAAACACUGUAAAUCUCUAAAAGAGACCA

Visualisation