RNA chain A

Viral RNA

Source organism: Brome mosaic virus [12302]
Expression system: Not provided
As chain: A
Length: 171 nucleotides
Theoretical weight: 55.04 KDa
FASTA Sequence
>pdb|7sam|A
GGCGUGGUUGACACGCAGACCUCUUACAAGAGUGUCUAGGUGCCUUUGAGAGUUACUCUUUGCUCUCUUCGGAAGAACCCUUAGGGGUUCGUGCAUGGGCUUGCAUAGCAAGUCUUAGAAUGCGGGUACCGUACAGUGUUGAAAAACACUGUAAAUCUCUAAAAGAGACCA

Visualisation