› › RNA chains A, B

E-site and P-site tRNA (fMet)

E-site and P-site tRNA (fMet) in PDB entry 6xdr, assembly 1, front view.
E-site and P-site tRNA (fMet) in PDB entry 6xdr, assembly 1, side view.
E-site and P-site tRNA (fMet) in PDB entry 6xdr, assembly 1, top view.
As chains: A, B
Length: 76 nucleotides
Theoretical weight: 24.5 KDa
Rfam:
FASTA Sequence
>pdb|6xdr|A B
CGCGGGGUGGAGCAGCCGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGUUCAAAUCCGGCCCCCGCAACCA

Visualisation

Quick links

Search similar RNA