› › DNA chain G

Forward strand of 23-RSS substrate DNA

Forward strand of 23-RSS substrate DNA in PDB entry 6dbv, assembly 1, front view.
Forward strand of 23-RSS substrate DNA in PDB entry 6dbv, assembly 1, side view.
Forward strand of 23-RSS substrate DNA in PDB entry 6dbv, assembly 1, top view.
As chain: G
Length: 61 nucleotides
Theoretical weight: 18.73 KDa
FASTA Sequence
>pdb|6dbv|G
GATCTGGCCTGTCTTACACAGTGGTAGTACTCCACTGTCTGGCTGTACAAAAACCCTGCAG

Visualisation

Quick links

Search similar DNA