5btl

X-ray diffraction
2.5Å resolution

Crystal structure of a topoisomerase II complex

Released:

Function and Biology Details

Structure analysis Details

Assembly composition:
hetero octamer (preferred)
Entry contents:
2 distinct polypeptide molecules
2 distinct DNA molecules
Macromolecules (4 distinct):
DNA gyrase subunit A Chains: A, C
Molecule details ›
Chains: A, C
Length: 503 amino acids
Theoretical weight: 56.21 KDa
Source organism: Mycobacterium tuberculosis H37Rv
Expression system: Escherichia coli
UniProt:
  • Canonical: P9WG47 (Residues: 2-500; Coverage: 60%)
Gene names: MTCY10H4.04, Rv0006, gyrA
Sequence domains: DNA gyrase/topoisomerase IV, subunit A
DNA gyrase subunit B Chains: B, D
Molecule details ›
Chains: B, D
Length: 253 amino acids
Theoretical weight: 28.27 KDa
Source organism: Mycobacterium tuberculosis CDC1551
Expression system: Escherichia coli
UniProt:
  • Canonical: P9WG44 (Residues: 426-675; Coverage: 37%)
Gene names: MT0005, gyrB
Sequence domains:
DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA Chains: E, H
Molecule details ›
Chains: E, H
Length: 24 nucleotides
Theoretical weight: 7.42 KDa
DNA substrate 24-mer TTACGTGCATAGTCATTCATGACC Chains: F, G
Molecule details ›
Chains: F, G
Length: 24 nucleotides
Theoretical weight: 7.32 KDa

Ligands and Environments

2 bound ligands:

1 modified residue:

Experiments and Validation Details

Entry percentile scores
X-ray source: APS BEAMLINE 24-ID-C
Spacegroup: P21
Unit cell:
a: 107.938Å b: 83.047Å c: 128.737Å
α: 90° β: 108.88° γ: 90°
R-values:
R R work R free
0.231 0.23 0.256
Expression system: Escherichia coli