› › RNA chains AY, AZ, CY, CZ

P and E-site tRNA(fMet)

P and E-site tRNA(fMet) in PDB entry 4v63, assembly 1, front view.
P and E-site tRNA(fMet) in PDB entry 4v63, assembly 1, side view.
P and E-site tRNA(fMet) in PDB entry 4v63, assembly 1, top view.
As chains: AY, AZ, CY, CZ
Length: 77 nucleotides
Theoretical weight: 24.8 KDa
Rfam:
FASTA Sequence
>pdb|4v63|AY AZ CY CZ
CGCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGUUCAAAUCCGGCCCCCGCAACCA

Visualisation

Quick links

Search similar RNA