RNA chain BA

tRNA

As chain: BA
Length: 76 nucleotides
Theoretical weight: 24.49 KDa
FASTA Sequence
>pdb|4ujd|BA
GCCCGGAUAGCUCAGUCGGUAGAGCAGGGGAUUGAAAAUCCCCGUGUCCUUGGUUCGAUUCCGAGUCCGGGCACCA

Visualisation