4p0r

X-ray diffraction
6.5Å resolution

human Mus81-Eme1-3'flap DNA complex

Released:

Function and Biology Details

Structure analysis Details

Assembly composition:
hetero pentamer (preferred)
Entry contents:
2 distinct polypeptide molecules
3 distinct DNA molecules
Macromolecules (5 distinct):
Crossover junction endonuclease MUS81 Chains: A, C
Molecule details ›
Chains: A, C
Length: 306 amino acids
Theoretical weight: 34.02 KDa
Source organism: Homo sapiens
Expression system: Escherichia coli
UniProt:
  • Canonical: Q96NY9 (Residues: 246-551; Coverage: 56%)
Gene name: MUS81
Sequence domains: ERCC4 domain
Crossover junction endonuclease EME1 Chains: B, D
Molecule details ›
Chains: B, D
Length: 393 amino acids
Theoretical weight: 43.74 KDa
Source organism: Homo sapiens
Expression system: Escherichia coli
UniProt:
  • Canonical: Q96AY2 (Residues: 178-570; Coverage: 69%)
Gene names: EME1, MMS4
Sequence domains: ERCC4 domain
DNA CTGTGTGTAAGCACG Chains: E, H
Molecule details ›
Chains: E, H
Length: 15 nucleotides
Theoretical weight: 4.63 KDa
DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT Chains: F, I
Molecule details ›
Chains: F, I
Length: 32 nucleotides
Theoretical weight: 9.91 KDa
DNA CAAGTTCACCCTAACCTCAG Chains: G, J
Molecule details ›
Chains: G, J
Length: 20 nucleotides
Theoretical weight: 6.02 KDa

Ligands and Environments

No bound ligands

No modified residues

Experiments and Validation Details

Entry percentile scores
X-ray source: PAL/PLS BEAMLINE 5C (4A)
Spacegroup: C2
Unit cell:
a: 221.757Å b: 135.3Å c: 102.889Å
α: 90° β: 113.27° γ: 90°
R-values:
R R work R free
0.214 0.21 0.295
Expression system: Escherichia coli