› › Structure analysis

Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid

Solution NMR
PDB entry 2m93 coloured by chain, ensemble of 10 models, front view.
PDB entry 2m93 coloured by chain, ensemble of 10 models, side view.
PDB entry 2m93 coloured by chain, ensemble of 10 models, top view.
Source organism: Synthetic construct
Assembly composition:
monomeric (preferred)
Entry contents: 1 distinct DNA molecule

Quick links

Assemblies

Assembly 1 (preferred)
Download    3D Visualisation
Assembly Name: DNA
hide full assembly name
Multimeric state: monomeric
Accessible surface area: 5993.26 Å2
Buried surface area: 0.0 Å2
Dissociation area: 0 Å2
Dissociation energy (ΔGdiss): 0 kcal/mol
Dissociation entropy (TΔSdiss): 0 kcal/mol
Symmetry number: 1
PDBe Complex ID: PDB-CPX-115599

Macromolecules

DNA chain A
Name: 32-MER DNA
Representative chains: A
Source organism: Synthetic construct [32630]
Expression system: Not provided
Length: 32 nucleotides
Theoretical weight: 10.07 KDa
32-MER DNA in PDB entry 2m93, assembly 1, front view.
32-MER DNA in PDB entry 2m93, assembly 1, side view.
32-MER DNA in PDB entry 2m93, assembly 1, top view.
Molecule details ›

Search similar DNA

Quick links