1sax

X-ray diffraction
2.8Å resolution

Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA

Released:

Function and Biology Details

Structure analysis Details

Assembly composition:
hetero tetramer (preferred)
Entry contents:
1 distinct polypeptide molecule
2 distinct DNA molecules
Macromolecules (3 distinct):
Methicillin resistance regulatory protein MecI Chains: A, B
Molecule details ›
Chains: A, B
Length: 123 amino acids
Theoretical weight: 14.81 KDa
Source organism: Staphylococcus aureus subsp. aureus N315
Expression system: Escherichia coli
UniProt:
  • Canonical: P68261 (Residues: 1-123; Coverage: 100%)
Gene names: SA0040, mecI
Structure domains:
5'-d(GCTCCGATATTACAGTTGTAATTTT)-3' Chain: C
Molecule details ›
Chain: C
Length: 25 nucleotides
Theoretical weight: 7.65 KDa
Source organism: Staphylococcus aureus subsp. aureus N315
Expression system: Not provided
5'-d(CAAAATTACAACTGTAATATCGGAG)-3' Chain: D
Molecule details ›
Chain: D
Length: 25 nucleotides
Theoretical weight: 7.7 KDa
Source organism: Staphylococcus aureus subsp. aureus N315
Expression system: Not provided

Ligands and Environments

1 bound ligand:
No modified residues

Experiments and Validation Details

Entry percentile scores
X-ray source: ESRF BEAMLINE ID13
Spacegroup: P3121
Unit cell:
a: 133.6Å b: 133.6Å c: 54.7Å
α: 90° β: 90° γ: 120°
R-values:
R R work R free
0.216 0.212 0.276
Expression systems:
  • Escherichia coli
  • Not provided