› 1kx4

X-ray diffraction
2.6Å resolution

X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution

Released:
DOI: 10.2210/pdb1kx4/pdb
PDB 1kx4 coloured by chain and viewed from the front.
PDB 1kx4 coloured by chain and viewed from the side.
PDB 1kx4 coloured by chain and viewed from the top.
Source organism: Xenopus laevis
Primary publication:
Solvent mediated interactions in the structure of the nucleosome core particle at 1.9 a resolution.
Davey CA, Sargent DF, Luger K, Maeder AW, Richmond TJ
J. Mol. Biol. 319 1097-113 (2002)
PMID: 12079350

Function and Biology Details

Biochemical function:
Biological process:
  • not assigned
Cellular component:
Sequence domains:
Structure domain:

Structure analysis Details

Assembly composition:
hetero decamer (preferred)
Entry contents:
4 distinct polypeptide molecules
1 distinct DNA molecule
Macromolecules (5 distinct):
Histone H3.2 Chains: A, E
Molecule details ›
Chains: A, E
Length: 135 amino acids
Theoretical weight: 15.3 KDa
Source organism: Xenopus laevis
Expression system: Escherichia coli
UniProt:
  • Canonical: P84233 (Residues: 2-136; Coverage: 99%)
Sequence domains: Core histone H2A/H2B/H3/H4
Structure domains: Histone, subunit A
Histone H4 Chains: B, F
Molecule details ›
Chains: B, F
Length: 102 amino acids
Theoretical weight: 11.26 KDa
Source organism: Xenopus laevis
Expression system: Escherichia coli
UniProt:
  • Canonical: P62799 (Residues: 2-103; Coverage: 99%)
Sequence domains: Centromere kinetochore component CENP-T histone fold
Structure domains: Histone, subunit A
Histone H2A type 1 Chains: C, G
Molecule details ›
Chains: C, G
Length: 128 amino acids
Theoretical weight: 13.91 KDa
Source organism: Xenopus laevis
Expression system: Escherichia coli
UniProt:
  • Canonical: P06897 (Residues: 2-130; Coverage: 99%)
Sequence domains:
Structure domains: Histone, subunit A
Histone H2B 1.1 Chains: D, H
Molecule details ›
Chains: D, H
Length: 125 amino acids
Theoretical weight: 13.85 KDa
Source organism: Xenopus laevis
Expression system: Escherichia coli
UniProt:
  • Canonical: P02281 (Residues: 2-126; Coverage: 99%)
Sequence domains: Core histone H2A/H2B/H3/H4
Structure domains: Histone, subunit A
DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3') Chains: I, J
Molecule details ›
Chains: I, J
Length: 146 nucleotides
Theoretical weight: 45.05 KDa

Ligands and Environments

2 bound ligands:
Ligand MN 6 x MN
Ligand CL 4 x CL
No modified residues

Experiments and Validation Details

Entry percentile scores
X-ray source: ESRF BEAMLINE ID09
Spacegroup: P212121
Unit cell:
a: 105.3Å b: 175.69Å c: 109.53Å
α: 90° β: 90° γ: 90°
R-values:
R R work R free
0.247 0.246 0.3
Expression system: Escherichia coli

Quick links

Citations

182 review citations

Chromatin Structure and Dynamics: Focus on Neuronal Differentiation and Pathological Implication.
Nothof et al. (2022)
181 more

14 mentions without citation

Nucleosome structural studies.
Tan et al. (2011)
13 more