› › DNA chains D, H

Pax5/Ets Binding Site on the mb-1 promoter

Pax5/Ets Binding Site on the mb-1 promoter in PDB entry 1k78, assembly 2, front view.
Pax5/Ets Binding Site on the mb-1 promoter in PDB entry 1k78, assembly 2, side view.
Pax5/Ets Binding Site on the mb-1 promoter in PDB entry 1k78, assembly 2, top view.
As chains: D, H
Length: 27 nucleotides
Theoretical weight: 8.23 KDa
FASTA Sequence
>pdb|1k78|D H
AAGGCCACTGGAGCCCATCTCCGGCAC

Visualisation

Quick links

Search similar DNA