EMD-6747 Function and Biology

RNA Polymerase II elongation complex bound with Spt4/5 and TFIIS

Single particle reconstruction
3.83Å resolution
Overview of EMD-6747
Sample name: RNA polymerase II elongation complex bound with Spt4/5 and TFIIS
Number of unique components: 23

RNA polymerase II elongation complex bound with Spt4/5 and TFIIS [Komagataella pastoris]

Protein type
Name: RNA polymerase II elongation complex bound with Spt4/5 and TFIIS

RNA polymerase II

Protein type
Name: RNA polymerase II

Spt4/5 and TFIIS

Protein type
Name: Spt4/5 and TFIIS

DNA-directed RNA polymerase subunit [Yeast]

Protein type
Name: DNA-directed RNA polymerase subunit
Theoretical weight (MDa): 0.194
Number of copies: 1

DNA-directed RNA polymerase subunit beta [Yeast]

Protein type
Name: DNA-directed RNA polymerase subunit beta
Theoretical weight (MDa): 0.14
Number of copies: 1

RNA polymerase II third largest subunit B44, part of central core [Yeast]

Protein type
Name: RNA polymerase II third largest subunit B44, part of central core
Theoretical weight (MDa): 0.034
Number of copies: 1

RNA polymerase II subunit B32 [Yeast]

Protein type
Name: RNA polymerase II subunit B32
Theoretical weight (MDa): 0.021
Number of copies: 1

RNA polymerase subunit ABC27, common to RNA polymerases I, II, and III [Yeast]

Protein type
Name: RNA polymerase subunit ABC27, common to RNA polymerases I, II, and III
Theoretical weight (MDa): 0.025
Number of copies: 1

RNA polymerase subunit ABC23, common to RNA polymerases I, II, and III [Yeast]

Protein type
Name: RNA polymerase subunit ABC23, common to RNA polymerases I, II, and III
Theoretical weight (MDa): 0.018
Number of copies: 1

RNA polymerase II subunit [Yeast]

Protein type
Name: RNA polymerase II subunit
Theoretical weight (MDa): 0.019
Number of copies: 1

RNA polymerase subunit ABC14.5, common to RNA polymerases I, II, and III [Yeast]

Protein type
Name: RNA polymerase subunit ABC14.5, common to RNA polymerases I, II, and III
Theoretical weight (MDa): 0.016
Number of copies: 1

DNA-directed RNA polymerase subunit [Yeast]

Protein type
Name: DNA-directed RNA polymerase subunit
Theoretical weight (MDa): 0.014
Number of copies: 1

RNA polymerase subunit ABC10-beta, common to RNA polymerases I, II, and III [Yeast]

Protein type
Name: RNA polymerase subunit ABC10-beta, common to RNA polymerases I, II, and III
Theoretical weight (MDa): 0.009
Number of copies: 1

RNA polymerase II subunit B12.5 [Yeast]

Protein type
Name: RNA polymerase II subunit B12.5
Theoretical weight (MDa): 0.014
Number of copies: 1

RNA polymerase subunit, found in RNA polymerase complexes I, II, and III [Yeast]

Protein type
Name: RNA polymerase subunit, found in RNA polymerase complexes I, II, and III
Theoretical weight (MDa): 0.008
Number of copies: 1

RNA (30-MER) [synthetic construct]

Nucleic-acid type
Name: RNA (30-MER)
Theoretical weight (MDa): 0.009
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: AUCUUGAAUCUAUUUCUUUUAUCGAGAGGU

DNA (48-MER) [synthetic construct]

Nucleic-acid type
Name: DNA (48-MER)
Theoretical weight (MDa): 0.015
Type: DNA
Structure: OTHER
Synthetic: false
Sequence: (DC)(DA)(DC)(DT)(DC)(DT)(DA)(DC)(DC)(DG)(DA)(DT)(DA)(DA)(DG)(DC)(DA)(DG)(DA)(DC) (DG)(DT)(DA)(DC)(DC)(DT)(DC)(DT)(DC)(DG)(DA)(DC)(DC)(DC)(DT)(DG)(DT)(DG)(DC)(DT) (DA)(DG)(DA)(DC)(DA)(DC)(DG)(DG)

DNA (48-MER) [synthetic construct]

Nucleic-acid type
Name: DNA (48-MER)
Theoretical weight (MDa): 0.015
Type: DNA
Structure: OTHER
Synthetic: false
Sequence: (DC)(DC)(DG)(DT)(DG)(DT)(DC)(DT)(DA)(DG)(DC)(DA)(DC)(DA)(DG)(DG)(DG)(DA)(DA)(DA) (DT)(DG)(DG)(DT)(DT)(DT)(DG)(DT)(DG)(DT)(DC)(DT)(DG)(DC)(DT)(DT)(DA)(DT)(DC)(DG) (DG)(DT)(DA)(DG)(DA)(DG)(DT)(DG)

General transcription elongation factor TFIIS [Komagataella phaffii (strain GS115 / ATCC 20864)]

Protein type
Name: General transcription elongation factor TFIIS
Theoretical weight (MDa): 0.022
Number of copies: 1
Expression system
Expression system: Escherichia coli

Transcription elongation factor SPT4 [Komagataella phaffii (strain GS115 / ATCC 20864)]

Protein type
Name: Transcription elongation factor SPT4
Theoretical weight (MDa): 0.012
Number of copies: 1
Expression system
Expression system: Escherichia coli

Protein that forms a complex with Spt4p [Komagataella phaffii (strain GS115 / ATCC 20864)]

Protein type
Name: Protein that forms a complex with Spt4p
Theoretical weight (MDa): 0.068
Number of copies: 1
Expression system
Expression system: Escherichia coli

ZINC ION

Ligand type
Name: ZINC ION
Theoretical weight (MDa): 0
Number of copies: 10

MAGNESIUM ION

Ligand type
Name: MAGNESIUM ION
Theoretical weight (MDa): 0
Number of copies: 1