EMD-3541 Function and Biology

Structure of a spliceosome remodeled for exon ligation

Single particle reconstruction
4.17Å resolution
Overview of EMD-3541
Sample name: Saccharomyces cerevisiae spliceosome. Complex C just after Prp16-mediated remodeling
Number of unique components: 42
Details: Splicing extract was prepared from Slu7-TAPS yeast strains. An in vitro transcribed yeast UBC4 pre-mRNA substrate (with 2 x MS2 bacteriophage coat protein-binding stem loops at the 5' end and with a 2'-deoxy substitution at the 3'-splice site sequence UAG sequence (UA-2'dG) was pre-bound to an MS2-maltose binding protein fusion protein. This substrate-protein complex was added to the splicing extract. The splicing reaction proceeded through the first step but the second step was blocked by the deoxy substitution. Substrate-bound spliceosomes from the splicing extract were purified on amylose resin and eluted with maltose. Subsequently the spliceosomes were captured on streptactin resin and eluted with desthiobiotin. Purified spliceosomes were concentrated in 20 mM HEPES KOH pH 7.9, 100 mM KCl, 0.25 mM EDTA.

Saccharomyces cerevisiae spliceosome. Complex C just after Prp16-mediated remodeling

Protein type
Name: Saccharomyces cerevisiae spliceosome. Complex C just after Prp16-mediated remodeling

Yeast UBC4 gene for ubiquitin-conjugating enzyme [Saccharomyces cerevisiae]

Nucleic-acid type
Name: Yeast UBC4 gene for ubiquitin-conjugating enzyme
Theoretical weight (MDa): 0.03
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: GUAUGUCUAAAGUUAUGGCCACGUUUCAAAUGCGUGCUUUUUUUUUAAAACUUAUGCUCUUAUUUACUAACAAAAUCAAC AUGCUAUUGAACUAG

5'-EXON OF UBC4 PRE-MRNA [Saccharomyces cerevisiae]

Nucleic-acid type
Name: 5'-EXON OF UBC4 PRE-MRNA
Theoretical weight (MDa): 0.007
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: GAAGUAAGUGAUCUAGAAAG

S.cerevisiae chromosome II reading frame ORF YBR230c [Baker's yeast]

Nucleic-acid type
Name: S.cerevisiae chromosome II reading frame ORF YBR230c
Theoretical weight (MDa): 0.376
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: ACGAAUCUCUUUGCCUUUUGGCUUAGAUCAAGUGUAGUAUCUGUUCUUUUCAGUGUAACAACUGAAAUGACCUCAAUGAG GCUCAUUACCUUUUAAUUUGUUACAAUACACAUUUUUUGGCACCCAAAAUAAUAAAAUGGACGGGAAGAGACUUUUUAAG CAAGUUGUUUUCCGCUAAUGUCAGGUCUCACUACUUUUUGCUGCUAUUUUUCUUCGCUCAUGGUUUCUUCAUAAGGCGUU UUUAUGAUGGUUUUUCGAAAUUGGUUUUUGAGACGACGGUUGCUCAAGGUUAUUGUUUUUGUUUUCUUCUGGUUGUUUUC UAUUUUCUUUUUUUUAGCUUUCUGUUUCUCCCUUAGUUUGGCUUUUUGCUUCAUACUCUUCCCUGUCUUUCCGAGCCGUU UAUGUCCAACGCGGGAUUUGGUUUUUCUUUAUCGAUGGGAAGAAAUGGUGCUAUAGUAGGUUGGGAGAUAAUAUUUAUGG UAUGGGGUGCUAGUGCGGAUGGGGCGCUCUUAUUGUUGAUUUCUUCGCUCGUCUUCUUUUUCUGGUGGCGCUGCAAGAGG AAGUUUUUCGACUUUGUUAUGAUUUUUGGUUUGCAAGGAAAGGUGUCUUACGAUUCUUUUUUUGAUGUAAUAGGAUAAGC UUGCUUAUCCCCCAAGUAUCGGCCAAAGUUGUUGAUUUUCCUUUUGAAGUGUCCUCGGUUUGAGGGGGUGUAGGGUGGGG UUGGUCUACAAUAAGAGUGUUCCAUUGUUAACGUGCUGGCGUCUUUUACUAUAUUUUUUUUCCCAGUUUAUUUUGUGCUU AUUUUCUCAUUGAGGAGAAGGAGCUCUUCUCGCAGGAUAUAAAUGGAGGUUUGCUAAAGGGGAGGAGAUGUGUUUGUGAG AAUACUGCUGAGAGAGUUCUGGAAGAGAAAAAAAGGAGGCAAUGGAAGGCGUUUGCUGGGAAAAGAGAAGAGCCAUGACU GCAUCUGUUGUUUCAAGGCCAGUUUUAUUAACCGCCUAUGUCAUAGAGGCGUUUUUUUUGGAGGGAUUUGAAGAAUGCCG GCGGCAUCAAGAAACGGACUUGAUGGUUGACGCCUGUUUUUAAAGUUAGAGACGUCGCGACCCUCGCACUUGUGGAGUCG UUCUUGACUUUUACUUUGGUCGCUUGAUGUUUCUCUCGUCUUCCCGUUCGCUCUU

Saccharomyces cerevisiae strain T.52_2H chromosome XII sequence [Baker's yeast]

Nucleic-acid type
Name: Saccharomyces cerevisiae strain T.52_2H chromosome XII sequence
Theoretical weight (MDa): 0.036
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: GUUCGCGAAGUAACCCUUCGUGGACAUUUGGUCAAUUUGAAACAAUACAGAGAUGAUCAGCAGUUCCCCUGCAUAAGGAU GAACCGUUUUACAAAGAGAUUUAUUUCGUUUU

Saccharomyces cerevisiae strain WI_C_MBSP_4 chromosome VII sequence [Baker's yeast]

Nucleic-acid type
Name: Saccharomyces cerevisiae strain WI_C_MBSP_4 chromosome VII sequence
Theoretical weight (MDa): 0.057
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: AAGCAGCUUUACAGAUCAAUGGCGGAGGGAGGUCAACAUCAAGAACUGUGGGCCUUUUAUUGCCUAUAGAACUUAUAACG AACAUGGUUCUUGCCUUUUACCAGAACCAUCCGGGUGUUGUCUCCAUAGAAACAGGUAAAGCUGUCCGUUACUGUGGGCU UGCCAUAUUUUUUGGAACU

Pre-mRNA-splicing factor 8 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor 8
Theoretical weight (MDa): 0.28
Number of copies: 1

Pre-mRNA-splicing factor SNU114 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor SNU114
Theoretical weight (MDa): 0.114
Number of copies: 1

Pre-mRNA-splicing factor CWC22 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor CWC22
Theoretical weight (MDa): 0.067
Number of copies: 1

Pre-mRNA-splicing factor PRP46 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor PRP46
Theoretical weight (MDa): 0.051
Number of copies: 1

Pre-mRNA-processing protein 45 [Baker's yeast]

Protein type
Name: Pre-mRNA-processing protein 45
Theoretical weight (MDa): 0.043
Number of copies: 1

Pre-mRNA-splicing factor BUD31 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor BUD31
Theoretical weight (MDa): 0.018
Number of copies: 1

Pre-mRNA-splicing factor CWC2 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor CWC2
Theoretical weight (MDa): 0.038
Number of copies: 1

Pre-mRNA-splicing factor SLT11 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor SLT11
Theoretical weight (MDa): 0.041
Number of copies: 1

Pre-mRNA-splicing factor CEF1 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor CEF1
Theoretical weight (MDa): 0.068
Number of copies: 1

Pre-mRNA-splicing factor CWC15 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor CWC15
Theoretical weight (MDa): 0.02
Number of copies: 1

Pre-mRNA-splicing factor CWC21 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor CWC21
Theoretical weight (MDa): 0.016
Number of copies: 1

Pre-mRNA-splicing factor CLF1 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor CLF1
Theoretical weight (MDa): 0.083
Number of copies: 1

Pre-mRNA-splicing factor SYF1,PRE-MRNA-SPLICING FACTOR SYF1 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor SYF1,PRE-MRNA-SPLICING FACTOR SYF1
Theoretical weight (MDa): 0.102
Number of copies: 1

Pre-mRNA-splicing factor 18 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor 18
Theoretical weight (MDa): 0.028
Number of copies: 1

Pre-mRNA-splicing factor SLU7 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor SLU7
Theoretical weight (MDa): 0.045
Number of copies: 1

Pre-mRNA-processing factor 17 [Baker's yeast]

Protein type
Name: Pre-mRNA-processing factor 17
Theoretical weight (MDa): 0.052
Number of copies: 1

UNKNOWN PROTEIN [Baker's yeast]

Protein type
Name: UNKNOWN PROTEIN
Theoretical weight (MDa): 0.006
Number of copies: 1

Pre-mRNA-splicing factor SYF2 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor SYF2
Theoretical weight (MDa): 0.025
Number of copies: 1

Small nuclear ribonucleoprotein-associated protein B [Baker's yeast]

Protein type
Name: Small nuclear ribonucleoprotein-associated protein B
Theoretical weight (MDa): 0.022
Number of copies: 2

Small nuclear ribonucleoprotein Sm D3 [Baker's yeast]

Protein type
Name: Small nuclear ribonucleoprotein Sm D3
Theoretical weight (MDa): 0.011
Number of copies: 2

Small nuclear ribonucleoprotein E [Baker's yeast]

Protein type
Name: Small nuclear ribonucleoprotein E
Theoretical weight (MDa): 0.01
Number of copies: 2

Small nuclear ribonucleoprotein F [Baker's yeast]

Protein type
Name: Small nuclear ribonucleoprotein F
Theoretical weight (MDa): 0.01
Number of copies: 2

Small nuclear ribonucleoprotein G [Baker's yeast]

Protein type
Name: Small nuclear ribonucleoprotein G
Theoretical weight (MDa): 0.008
Number of copies: 2

Small nuclear ribonucleoprotein Sm D1 [Baker's yeast]

Protein type
Name: Small nuclear ribonucleoprotein Sm D1
Theoretical weight (MDa): 0.016
Number of copies: 2

Small nuclear ribonucleoprotein Sm D2 [Baker's yeast]

Protein type
Name: Small nuclear ribonucleoprotein Sm D2
Theoretical weight (MDa): 0.013
Number of copies: 2

Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP22 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP22
Theoretical weight (MDa): 0.13
Number of copies: 1

U2 small nuclear ribonucleoprotein A' [Baker's yeast]

Protein type
Name: U2 small nuclear ribonucleoprotein A'
Theoretical weight (MDa): 0.027
Number of copies: 1

U2 small nuclear ribonucleoprotein B'' [Baker's yeast]

Protein type
Name: U2 small nuclear ribonucleoprotein B''
Theoretical weight (MDa): 0.013
Number of copies: 1

3'-EXON OF UBC4 PRE-MRNA, BOUND BY PRP22 HELICASE [Saccharomyces cerevisiae]

Nucleic-acid type
Name: 3'-EXON OF UBC4 PRE-MRNA, BOUND BY PRP22 HELICASE
Theoretical weight (MDa): 0.001
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: UUU

Pre-mRNA-splicing factor SNT309 [Baker's yeast]

Protein type
Name: Pre-mRNA-splicing factor SNT309
Theoretical weight (MDa): 0.021
Number of copies: 1

Pre-mRNA-processing factor 19 [Baker's yeast]

Protein type
Name: Pre-mRNA-processing factor 19
Theoretical weight (MDa): 0.057
Number of copies: 4

MAGNESIUM ION

Ligand type
Name: MAGNESIUM ION
Theoretical weight (MDa): 0
Number of copies: 3

POTASSIUM ION

Ligand type
Name: POTASSIUM ION
Theoretical weight (MDa): 0
Number of copies: 2

INOSITOL 1,2,3,4,5,6-HEXAKISPHOSPHATE

Ligand type
Name: INOSITOL 1,2,3,4,5,6-HEXAKISPHOSPHATE
Theoretical weight (MDa): 0.001
Number of copies: 1

GUANOSINE-5'-TRIPHOSPHATE

Ligand type
Name: GUANOSINE-5'-TRIPHOSPHATE
Theoretical weight (MDa): 0.001
Number of copies: 1

ZINC ION

Ligand type
Name: ZINC ION
Theoretical weight (MDa): 0
Number of copies: 6