EMD-3532 Function and Biology

Cryo-EM reconstruction of the small subunit of the chloroplast ribosome

Single particle reconstruction
3.6Å resolution
Overview of EMD-3532
Sample name: Chloroplast 70S ribosome
Number of unique components: 29

Chloroplast 70S ribosome [Spinacia oleracea]

Protein type
Name: Chloroplast 70S ribosome
Theoretical weight (MDa): 2.4
Natural source of the component
Organism: Spinacia oleracea
Organ/Tissue: leaf
Organelle: chloroplast

50S ribosomal protein L31 [Spinach]

Protein type
Name: 50S ribosomal protein L31
Theoretical weight (MDa): 0.015
Number of copies: 1

plastid ribosomal protein bS1c [Spinach]

Protein type
Name: plastid ribosomal protein bS1c
Theoretical weight (MDa): 0.015
Number of copies: 1

16S ribosomal RNA [Spinacia oleracea]

Nucleic-acid type
Name: 16S ribosomal RNA
Theoretical weight (MDa): 0.483
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: UCUCAUGGAGAGUUCGAUCCUGGCUCAGGAUGAACGCUGGCGGCAUGCUUAACACAUGCAAGUCGGACGGGAAGUGGUGU UUCCAGUGGCGGACGGGUGAGUAACGCGUAAGAACCUGCCCUUGGGAGGGGAACAACAGCUGGAAACGGCUGCUAAUACC CCGUAGGCUGAGAAGCAAAAGGAGGAAUCCGCCCGAGGAGGGGCUCGCGUCUGAUUAGCUAGUUGGUGAGGUAAUAGCUU ACCAAGGCGAUGAUCAGUAGCUGGUCCGAGAGGAUGAUCAGCCACACUGGGACUGAGACACGGCCCAGACUCCUACGGGA GGCAGCAGUGGGGAAUUUUCCGCAAUGGGCGAAAGCCUGACGGAGCAAUGCCGCGUGGAGGCAGAAGGCCCACGGGUCGU GAACUUCUUUUCCCGGAGAAGAAGCAAUGACGGUAUCCGGGGAAUAAGCAUCGGCUAACUCUGUGCCAGCAGCCGCGGUA AGACAGAGGAUGCAAGCGUUAUCCGGAAUGAUUGGGCGUAAAGCGUCUGUAGGUGGCUUUUUAAGUCCGCCGUCAAAUCC CAGGGCUCAACCCUGGACAGGCGGUGGAAACUACCAAGCUGGAGUACGGUAGGGGCAGAGGGAAUUUCCGGUGGAGCGGU GAAAUGCGUAGAGAUCGGAAAGAACACCAACGGCGAAAGCACUCUGCUGGGCCGACACUGACACUGAGAGACGAAAGCUA GGGGAGCGAAUGGGAUUAGAUACCCCAGUAGUCCUAGCCGUAAACGAUGGAUACUAGGCGCUGUGCGUAUCGACCCGUGC AGUGUUGUAGCUAACGCGUUAAGUAUCCCGCCUGGGGAGUACGUUCGCAAGAAUGAAACUCAAAGGAAUUGACGGGGGCC CGCACAAGCGGUGGAGCAUGUGGUUUAAUUCGAUGCAAAGCGAAGAACCUUACCAGGGCUUGACAUGCCGCGAAUCCUCU UGAAAGAGAGGGGUGCCUUCGGGAACGCGGACACAGGUGGUGCAUGGCUGUCGUCAGCUCGUGCCGUAAGGUGUUGGGUU AAGUCCCGCAACGAGCGCAACCCUCGUGUUUAGUUGCCAACGUUGAGUUUGGAACCCUGAACAGACUGCCGGUGAUAAGC CGGAGGAAGGUGAGGAUGACGUCAAGUCAUCAUGCCCCUUAUGCCCUGGGCGACACACGUGCUACAAUGGCCGGGACAAA GGGUCGCGAUCCCGCGAGGGUGAGCUAACCCCAAAAACCCGUCCUCAGUUCGGAUUGCAGGCUGCAACUCGCCUGCAUGA AGCCGGAAUCGCUAGUAAUCGCCGGUCAGCCAUACGGCGGUGAAUUCGUUCCCGGGCCUUGUACACACCGCCCGUCACAC UAUGGGAGCUGGCCAUGCCCGAAGUCGUUACCUUAACCGCAAGGAGGGGGAUGCCGAAGGCAGGGCUAGUGACUGGAGUG AAGUCGUAACAAGGUAGCCGUACUGGAAGGUGCGGCUGGAUCACCUCCUUU

30S ribosomal protein S2, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein S2, chloroplastic
Theoretical weight (MDa): 0.027
Number of copies: 1

30S ribosomal protein S3, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein S3, chloroplastic
Theoretical weight (MDa): 0.025
Number of copies: 1

30S ribosomal protein S4, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein S4, chloroplastic
Theoretical weight (MDa): 0.023
Number of copies: 1

30S ribosomal protein S5, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein S5, chloroplastic
Theoretical weight (MDa): 0.034
Number of copies: 1

plastid ribosomal protein bS6c [Spinach]

Protein type
Name: plastid ribosomal protein bS6c
Theoretical weight (MDa): 0.024
Number of copies: 1

30S ribosomal protein S7, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein S7, chloroplastic
Theoretical weight (MDa): 0.017
Number of copies: 1

30S ribosomal protein S8, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein S8, chloroplastic
Theoretical weight (MDa): 0.016
Number of copies: 1

plastid ribosomal protein uS9c [Spinach]

Protein type
Name: plastid ribosomal protein uS9c
Theoretical weight (MDa): 0.022
Number of copies: 1

plastid ribosomal protein uS10c [Spinach]

Protein type
Name: plastid ribosomal protein uS10c
Theoretical weight (MDa): 0.021
Number of copies: 1

30S ribosomal protein S11, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein S11, chloroplastic
Theoretical weight (MDa): 0.015
Number of copies: 1

30S ribosomal protein S12, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein S12, chloroplastic
Theoretical weight (MDa): 0.014
Number of copies: 1

plastid ribosomal protein uS13c [Spinach]

Protein type
Name: plastid ribosomal protein uS13c
Theoretical weight (MDa): 0.019
Number of copies: 1

30S ribosomal protein S14, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein S14, chloroplastic
Theoretical weight (MDa): 0.012
Number of copies: 1

30S ribosomal protein S15, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein S15, chloroplastic
Theoretical weight (MDa): 0.011
Number of copies: 1

30S ribosomal protein S16, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein S16, chloroplastic
Theoretical weight (MDa): 0.01
Number of copies: 1

plastid ribosomal protein uS17c [Spinach]

Protein type
Name: plastid ribosomal protein uS17c
Theoretical weight (MDa): 0.018
Number of copies: 1

30S ribosomal protein S18, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein S18, chloroplastic
Theoretical weight (MDa): 0.012
Number of copies: 1

30S ribosomal protein S19 alpha, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein S19 alpha, chloroplastic
Theoretical weight (MDa): 0.011
Number of copies: 1

plastid ribosomal protein bS20c [Spinach]

Protein type
Name: plastid ribosomal protein bS20c
Theoretical weight (MDa): 0.02
Number of copies: 1

plastid ribosomal protein bS21c [Spinach]

Protein type
Name: plastid ribosomal protein bS21c
Theoretical weight (MDa): 0.021
Number of copies: 1

30S ribosomal protein 2, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein 2, chloroplastic
Theoretical weight (MDa): 0.028
Number of copies: 1

30S ribosomal protein 3, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein 3, chloroplastic
Theoretical weight (MDa): 0.02
Number of copies: 1

30S ribosomal protein S31, chloroplastic [Spinach]

Protein type
Name: 30S ribosomal protein S31, chloroplastic
Theoretical weight (MDa): 0.011
Number of copies: 1

Ribosome-binding factor PSRP1, chloroplastic [Spinach]

Protein type
Name: Ribosome-binding factor PSRP1, chloroplastic
Theoretical weight (MDa): 0.034
Number of copies: 1

MAGNESIUM ION

Ligand type
Name: MAGNESIUM ION
Theoretical weight (MDa): 0
Number of copies: 185