EMD-11972 Function and Biology

Overall map of a transcribing RNA polymerase II-U1 snRNP complex with 145-nt RNA

Single particle reconstruction
3.6Å resolution
Overview of EMD-11972
Sample name: The transcribing RNA polymerase II-U1 snRNP complex with 145-nt RNA
Number of unique components: 31

The transcribing RNA polymerase II-U1 snRNP complex with 145-nt RNA

Protein type
Name: The transcribing RNA polymerase II-U1 snRNP complex with 145-nt RNA

RNA polymerase II [Sus scrofa domesticus]

Protein type
Name: RNA polymerase II

Nucleic acids [synthetic construct]

Protein type
Name: Nucleic acids
Expression system
Expression system: synthetic construct

U1 snRNP [Homo sapiens]

Protein type
Name: U1 snRNP

DNA-directed RNA polymerase II subunit RPB1 [Sus scrofa domesticus]

Protein type
Name: DNA-directed RNA polymerase II subunit RPB1
Theoretical weight (MDa): 0.217
Number of copies: 1

DNA-directed RNA polymerase subunit beta [Sus scrofa domesticus]

Protein type
Name: DNA-directed RNA polymerase subunit beta
Theoretical weight (MDa): 0.134
Number of copies: 1

DNA-directed RNA polymerase II subunit RPB3 [Sus scrofa domesticus]

Protein type
Name: DNA-directed RNA polymerase II subunit RPB3
Theoretical weight (MDa): 0.031
Number of copies: 1

DNA-directed RNA polymerase II subunit D [Sus scrofa domesticus]

Protein type
Name: DNA-directed RNA polymerase II subunit D
Theoretical weight (MDa): 0.016
Number of copies: 1

DNA-directed RNA polymerase II subunit E [Sus scrofa domesticus]

Protein type
Name: DNA-directed RNA polymerase II subunit E
Theoretical weight (MDa): 0.025
Number of copies: 1

DNA-directed RNA polymerase II subunit F [Sus scrofa domesticus]

Protein type
Name: DNA-directed RNA polymerase II subunit F
Theoretical weight (MDa): 0.014
Number of copies: 1

DNA-directed RNA polymerase II subunit RPB7 [Sus scrofa domesticus]

Protein type
Name: DNA-directed RNA polymerase II subunit RPB7
Theoretical weight (MDa): 0.019
Number of copies: 1

DNA-directed RNA polymerases I, II, and III subunit RPABC3 [Sus scrofa domesticus]

Protein type
Name: DNA-directed RNA polymerases I, II, and III subunit RPABC3
Theoretical weight (MDa): 0.017
Number of copies: 1

DNA-directed RNA polymerase II subunit RPB9 [Sus scrofa domesticus]

Protein type
Name: DNA-directed RNA polymerase II subunit RPB9
Theoretical weight (MDa): 0.015
Number of copies: 1

DNA-directed RNA polymerases I, II, and III subunit RPABC5 [Sus scrofa domesticus]

Protein type
Name: DNA-directed RNA polymerases I, II, and III subunit RPABC5
Theoretical weight (MDa): 0.008
Number of copies: 1

DNA-directed RNA polymerase II subunit RPB11-a [Sus scrofa domesticus]

Protein type
Name: DNA-directed RNA polymerase II subunit RPB11-a
Theoretical weight (MDa): 0.013
Number of copies: 1

RPB12 [Sus scrofa domesticus]

Protein type
Name: RPB12
Theoretical weight (MDa): 0.007
Number of copies: 1

Non-template DNA [synthetic construct]

Nucleic-acid type
Name: Non-template DNA
Theoretical weight (MDa): 0.015
Type: DNA
Structure: OTHER
Synthetic: false
Sequence: (DC)(DC)(DA)(DT)(DT)(DG)(DA)(DG)(DA)(DG)(DC)(DG)(DG)(DC)(DC)(DC)(DT)(DT)(DG)(DT) (DG)(DT)(DT)(DC)(DA)(DG)(DG)(DA)(DG)(DC)(DC)(DA)(DG)(DC)(DA)(DG)(DG)(DG)(DA)(DG) (DC)(DT)(DG)(DG)(DG)(DA)(DG)(DC)

145-nt RNA [synthetic construct]

Nucleic-acid type
Name: 145-nt RNA
Theoretical weight (MDa): 0.047
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: GGGCGUACACCAUCAGGGUACGAGCUAGCCCAUGGCGUACACCAUCAGGGUACGACUAGUAGAUCUCGUACACCAUCAGG GUACGCUUGGAUCGGAAACCCGUCGGCCUCCGACAGGUAAGUAUUAACCGGAGAGGGAACCCACU

Template DNA [synthetic construct]

Nucleic-acid type
Name: Template DNA
Theoretical weight (MDa): 0.015
Type: DNA
Structure: OTHER
Synthetic: false
Sequence: (DG)(DC)(DT)(DC)(DC)(DC)(DA)(DG)(DC)(DT)(DC)(DC)(DC)(DT)(DG)(DC)(DT)(DG)(DG)(DC) (DT)(DC)(DC)(DG)(DA)(DG)(DT)(DG)(DG)(DG)(DT)(DT)(DC)(DT)(DG)(DC)(DC)(DG)(DC)(DT) (DC)(DT)(DC)(DA)(DA)(DT)(DG)(DG)

U1 snRNA [Human]

Nucleic-acid type
Name: U1 snRNA
Theoretical weight (MDa): 0.053
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: AUACUUACCUGGCAGGGGAGAUACCAUGAUCACGAAGGUGGUUUUCCCAGGGCGAGGCUUAUCCAUUGCACUCCGGAUGU GCUGACCCCUGCGAUUUCCCCAAAUGUGGGAAACUCGACUGCAUAAUUUGUGGUAGUGGGGGACUGCGUUCGCGCUUUCC CCUG

U1 small nuclear ribonucleoprotein 70 kDa [Human]

Protein type
Name: U1 small nuclear ribonucleoprotein 70 kDa
Theoretical weight (MDa): 0.052
Number of copies: 1

U1 small nuclear ribonucleoprotein A [Human]

Protein type
Name: U1 small nuclear ribonucleoprotein A
Theoretical weight (MDa): 0.031
Number of copies: 1

Small nuclear ribonucleoprotein Sm D2 [Human]

Protein type
Name: Small nuclear ribonucleoprotein Sm D2
Theoretical weight (MDa): 0.014
Number of copies: 1

Small nuclear ribonucleoprotein F [Human]

Protein type
Name: Small nuclear ribonucleoprotein F
Theoretical weight (MDa): 0.01
Number of copies: 1

Small nuclear ribonucleoprotein E [Human]

Protein type
Name: Small nuclear ribonucleoprotein E
Theoretical weight (MDa): 0.011
Number of copies: 1

Small nuclear ribonucleoprotein G [Human]

Protein type
Name: Small nuclear ribonucleoprotein G
Theoretical weight (MDa): 0.009
Number of copies: 1

Small nuclear ribonucleoprotein Sm D3 [Human]

Protein type
Name: Small nuclear ribonucleoprotein Sm D3
Theoretical weight (MDa): 0.014
Number of copies: 1

Small nuclear ribonucleoprotein-associated protein [Human]

Protein type
Name: Small nuclear ribonucleoprotein-associated protein
Theoretical weight (MDa): 0.024
Number of copies: 1

Small nuclear ribonucleoprotein Sm D1 [Human]

Protein type
Name: Small nuclear ribonucleoprotein Sm D1
Theoretical weight (MDa): 0.013
Number of copies: 1

ZINC ION

Ligand type
Name: ZINC ION
Theoretical weight (MDa): 0
Number of copies: 8

MAGNESIUM ION

Ligand type
Name: MAGNESIUM ION
Theoretical weight (MDa): 0
Number of copies: 1