EMD-11821 Function and Biology

Intermediate assembly of the Large subunit from Leishmania major mitochondrial ribosome

Single particle reconstruction
3.4Å resolution
Overview of EMD-11821
Sample name: Leishmania mitochondrial ribosome
Number of unique components: 80

Leishmania mitochondrial ribosome [Leishmania tarentolae]

Protein type
Name: Leishmania mitochondrial ribosome

Ribosomal protein L3-like protein [Leishmania tarentolae]

Protein type
Name: Ribosomal protein L3-like protein
Theoretical weight (MDa): 0.054
Number of copies: 1

uL4m [Leishmania tarentolae]

Protein type
Name: uL4m
Theoretical weight (MDa): 0.05
Number of copies: 1

RIBOSOMAL_L9 domain-containing protein [Leishmania tarentolae]

Protein type
Name: RIBOSOMAL_L9 domain-containing protein
Theoretical weight (MDa): 0.031
Number of copies: 1

Putative ribosomal protein L11 [Leishmania tarentolae]

Protein type
Name: Putative ribosomal protein L11
Theoretical weight (MDa): 0.04
Number of copies: 1

50S ribosomal protein L13-like protein [Leishmania tarentolae]

Protein type
Name: 50S ribosomal protein L13-like protein
Theoretical weight (MDa): 0.021
Number of copies: 1

Ribosomal_L18e/L15P domain-containing protein [Leishmania tarentolae]

Protein type
Name: Ribosomal_L18e/L15P domain-containing protein
Theoretical weight (MDa): 0.044
Number of copies: 1

Putative 50S ribosomal protein L17 [Leishmania tarentolae]

Protein type
Name: Putative 50S ribosomal protein L17
Theoretical weight (MDa): 0.036
Number of copies: 1

bL19m [Leishmania tarentolae]

Protein type
Name: bL19m
Theoretical weight (MDa): 0.017
Number of copies: 1

bL20m [Leishmania tarentolae]

Protein type
Name: bL20m
Theoretical weight (MDa): 0.022
Number of copies: 1

bL21m [Leishmania tarentolae]

Protein type
Name: bL21m
Theoretical weight (MDa): 0.021
Number of copies: 1

uL22m [Leishmania tarentolae]

Protein type
Name: uL22m
Theoretical weight (MDa): 0.032
Number of copies: 1

uL23m [Leishmania tarentolae]

Protein type
Name: uL23m
Theoretical weight (MDa): 0.029
Number of copies: 1

uL24m [Leishmania tarentolae]

Protein type
Name: uL24m
Theoretical weight (MDa): 0.054
Number of copies: 1

bL28m [Leishmania tarentolae]

Protein type
Name: bL28m
Theoretical weight (MDa): 0.027
Number of copies: 1

uL29m [Leishmania tarentolae]

Protein type
Name: uL29m
Theoretical weight (MDa): 0.054
Number of copies: 1

uL30m [Leishmania tarentolae]

Protein type
Name: uL30m
Theoretical weight (MDa): 0.046
Number of copies: 1

bL32m [Leishmania tarentolae]

Protein type
Name: bL32m
Theoretical weight (MDa): 0.01
Number of copies: 1

bL35m [Leishmania tarentolae]

Protein type
Name: bL35m
Theoretical weight (MDa): 0.018
Number of copies: 1

mL41 [Leishmania tarentolae]

Protein type
Name: mL41
Theoretical weight (MDa): 0.023
Number of copies: 1

mL94 [Leishmania tarentolae]

Protein type
Name: mL94
Theoretical weight (MDa): 0.018
Number of copies: 1

TRUD domain-containing protein [Leishmania tarentolae]

Protein type
Name: TRUD domain-containing protein
Theoretical weight (MDa): 0.068
Number of copies: 1

UA [Leishmania tarentolae]

Protein type
Name: UA
Theoretical weight (MDa): 0.014
Number of copies: 1

mL95 [Leishmania tarentolae]

Protein type
Name: mL95
Theoretical weight (MDa): 0.019
Number of copies: 1

RNA uridylyltransferase [Leishmania tarentolae]

Protein type
Name: RNA uridylyltransferase
Theoretical weight (MDa): 0.023
Number of copies: 1

mL67 [Leishmania tarentolae]

Protein type
Name: mL67
Theoretical weight (MDa): 0.098
Number of copies: 1

mL71 [Leishmania tarentolae]

Protein type
Name: mL71
Theoretical weight (MDa): 0.049
Number of copies: 1

mL81 [Leishmania tarentolae]

Protein type
Name: mL81
Theoretical weight (MDa): 0.038
Number of copies: 1

mL98 [Leishmania tarentolae]

Protein type
Name: mL98
Theoretical weight (MDa): 0.013
Number of copies: 1

Putative ribosomal protein L14 [Leishmania tarentolae]

Protein type
Name: Putative ribosomal protein L14
Theoretical weight (MDa): 0.022
Number of copies: 1

mL86 [Leishmania tarentolae]

Protein type
Name: mL86
Theoretical weight (MDa): 0.021
Number of copies: 1

mL87 [Leishmania tarentolae]

Protein type
Name: mL87
Theoretical weight (MDa): 0.022
Number of copies: 1

mL53 [Leishmania tarentolae]

Protein type
Name: mL53
Theoretical weight (MDa): 0.035
Number of copies: 1

mL63 [Leishmania tarentolae]

Protein type
Name: mL63
Theoretical weight (MDa): 0.018
Number of copies: 1

mL68 [Leishmania tarentolae]

Protein type
Name: mL68
Theoretical weight (MDa): 0.066
Number of copies: 1

mL80 [Leishmania tarentolae]

Protein type
Name: mL80
Theoretical weight (MDa): 0.028
Number of copies: 1

mL74 [Leishmania tarentolae]

Protein type
Name: mL74
Theoretical weight (MDa): 0.039
Number of copies: 1

L51_S25_CI-B8 domain-containing protein [Leishmania tarentolae]

Protein type
Name: L51_S25_CI-B8 domain-containing protein
Theoretical weight (MDa): 0.031
Number of copies: 1

mL42 [Leishmania tarentolae]

Protein type
Name: mL42
Theoretical weight (MDa): 0.022
Number of copies: 1

mL52,mL52 [Leishmania tarentolae]

Protein type
Name: mL52,mL52
Theoretical weight (MDa): 0.029
Number of copies: 1

mL93 [Leishmania tarentolae]

Protein type
Name: mL93
Theoretical weight (MDa): 0.019
Number of copies: 1

mL75 [Leishmania tarentolae]

Protein type
Name: mL75
Theoretical weight (MDa): 0.04
Number of copies: 1

mL85 [Leishmania tarentolae]

Protein type
Name: mL85
Theoretical weight (MDa): 0.028
Number of copies: 1

mL100 [Leishmania tarentolae]

Protein type
Name: mL100
Theoretical weight (MDa): 0.147
Number of copies: 1

mL49 [Leishmania tarentolae]

Protein type
Name: mL49
Theoretical weight (MDa): 0.026
Number of copies: 1

mL89 [Leishmania tarentolae]

Protein type
Name: mL89
Theoretical weight (MDa): 0.022
Number of copies: 1

Peptidyl-prolyl cis-trans isomerase [Leishmania tarentolae]

Protein type
Name: Peptidyl-prolyl cis-trans isomerase
Theoretical weight (MDa): 0.025
Number of copies: 1

mL72 [Leishmania tarentolae]

Protein type
Name: mL72
Theoretical weight (MDa): 0.057
Number of copies: 1

mL84 [Leishmania tarentolae]

Protein type
Name: mL84
Theoretical weight (MDa): 0.025
Number of copies: 1

mL76 [Leishmania tarentolae]

Protein type
Name: mL76
Theoretical weight (MDa): 0.039
Number of copies: 1

mL99 [Leishmania tarentolae]

Protein type
Name: mL99
Theoretical weight (MDa): 0.013
Number of copies: 1

mL88 [Leishmania tarentolae]

Protein type
Name: mL88
Theoretical weight (MDa): 0.022
Number of copies: 1

mL70 [Leishmania tarentolae]

Protein type
Name: mL70
Theoretical weight (MDa): 0.051
Number of copies: 1

mL59/64 [Leishmania tarentolae]

Protein type
Name: mL59/64
Theoretical weight (MDa): 0.029
Number of copies: 1

Peptidyl-prolyl cis-trans isomerase [Leishmania tarentolae]

Protein type
Name: Peptidyl-prolyl cis-trans isomerase
Theoretical weight (MDa): 0.029
Number of copies: 1

LIM zinc-binding domain-containing protein [Leishmania tarentolae]

Protein type
Name: LIM zinc-binding domain-containing protein
Theoretical weight (MDa): 0.025
Number of copies: 1

DNAj-like protein [Leishmania tarentolae]

Protein type
Name: DNAj-like protein
Theoretical weight (MDa): 0.045
Number of copies: 1

SpoU_methylase domain-containing protein [Leishmania tarentolae]

Protein type
Name: SpoU_methylase domain-containing protein
Theoretical weight (MDa): 0.064
Number of copies: 2

Pseudouridylate synthase-like protein [Leishmania tarentolae]

Protein type
Name: Pseudouridylate synthase-like protein
Theoretical weight (MDa): 0.047
Number of copies: 1

Acyl carrier protein [Leishmania tarentolae]

Protein type
Name: Acyl carrier protein
Theoretical weight (MDa): 0.017
Number of copies: 1

L0R8F8 [Leishmania tarentolae]

Protein type
Name: L0R8F8
Theoretical weight (MDa): 0.015
Number of copies: 1

G domain-containing protein [Leishmania tarentolae]

Protein type
Name: G domain-containing protein
Theoretical weight (MDa): 0.052
Number of copies: 1

GTPase Der [Leishmania tarentolae]

Protein type
Name: GTPase Der
Theoretical weight (MDa): 0.057
Number of copies: 1

DEAD/DEAH box helicase-like protein [Leishmania tarentolae]

Protein type
Name: DEAD/DEAH box helicase-like protein
Theoretical weight (MDa): 0.087
Number of copies: 1

G domain-containing protein [Leishmania tarentolae]

Protein type
Name: G domain-containing protein
Theoretical weight (MDa): 0.087
Number of copies: 1

mL78 [Leishmania tarentolae]

Protein type
Name: mL78
Theoretical weight (MDa): 0.003
Number of copies: 1

U6 [Leishmania tarentolae]

Protein type
Name: U6
Theoretical weight (MDa): 0.013
Number of copies: 1

U1 [Leishmania tarentolae]

Protein type
Name: U1
Theoretical weight (MDa): 0.003
Number of copies: 1

U3 [Leishmania tarentolae]

Protein type
Name: U3
Theoretical weight (MDa): 0.005
Number of copies: 1

U4 [Leishmania tarentolae]

Protein type
Name: U4
Theoretical weight (MDa): 0.01
Number of copies: 1

U5 [Leishmania tarentolae]

Protein type
Name: U5
Theoretical weight (MDa): 0.007
Number of copies: 1

mL78 [Leishmania tarentolae]

Protein type
Name: mL78
Theoretical weight (MDa): 0.033
Number of copies: 1

U2 [Leishmania tarentolae]

Protein type
Name: U2
Theoretical weight (MDa): 0.003
Number of copies: 1

Ribosomal RNA [Leishmania tarentolae]

Nucleic-acid type
Name: Ribosomal RNA
Theoretical weight (MDa): 6.062
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: UUUCAAAAAUUGACUAAUUUUGAUAUUGUUUUGGCUCUGGACUAAUUAAUUCUCCUUUAAUUUUAUUAUCUAAAAUUUGC AUACUUACAUAUUAAAGUAGUUAGUUUAGAUAUGAAAAUUAGUUAGAUUUCCAUUUGAAUUAGUUAUGUUAAAUAUAGAA UUAGUUAGGGUUGAUAAUGAAAUCAAUUAAGUUUAUAUAUAAAGUUAGUUAGUCAAUAUGAAUUUUUUUGCAAACAUUUC CGGUUGACUUCAUGUGAUUACACGUACUCCGUUUUGUUUUUAUGUGUCAUGAUUUGCAUUGAUUUUUUCGCAACCACACC AUAAAUCUAAUAUACUCAACAGCACCUACCAAGAGUUAAAAAUGAAAUUAAAUAAAAAUAAAAAAUAAAAUAAAAAUAAA AUAAAAAUAAAUUUAAAAAUAAAAAUAAGUUUAAAAAAUAAAUUAAAAUAAAAAAUUAUAAAAUGGAAAUUGAAAAAUAA AUUACAAAUAAAAGAUUAAAUUUGAAUUAAUUACAGAAAUUAGACACAACACGCCCGAUCGAUUUCAUGCAUACACUUUU ACUUCGUUUUCGGUUUACGUUUUGUUGUUUGUAUUGGCUCGAUGGAUGAAUAUAAAAAGCUUAAAUACAAAAUUUCCAAC AAUUGGAUAAGCAAGAGUUAAAAAAUGAAAUUAAAUAAAAAUAAAAAAUAAAAUAAAAUAAAAUUAAAAUAAAAUAAAAA AUAAAAAAUUAAAAAUAAAAUUAAAAUAAAAAGUUAGAAAAUAAAAAAUUUAAAAAAUAUAAUUUGAAAAAUAAAUUACA AAUAAAAGAUUAAAUUUGAAUUAAUUGCAGACACUAGACACACAUUUCCGAUCGAUUUCACGUAUACAUUUGUACUUCGU UUUUGGUUUAUGUUUUGUUGUUUGCACUGAUCGAGCAAAAUUUUUAUUUUAUAUAUAAUUUAAACUUUUGUUGUUGUUUG UUAGUAAGCAAAAAUAUUUAUGUCAUUUUAAUAUUAUUUAUGUACUUACUAUUAUUUUGAUAAAUUUUAACUUUAAAUAG CAUAAAAACUACAAUCAAUAAAGCAUAAAAAAAUUUAUUUAUGAUUAUAUUAAUAUAAAAUGACCUAAUAUAAUGAAAAU ACUUUAGUGUUAAGUUAUUUGUUUUAUUAUGAAAUAAGUUGCACUAUUUAUUGAAUUAAUAAAGAAAGAAUAGAAAUAAA UAAGUUAUAAUAUCUUUAAUUUAUUUAUAAUUUCUUUGCAUUUGUAUUUAGUGUGAGUUUACAUUUAAUUUUAUAUUAUU UUAGUGUUAGUAUAUAUUUAAAUUUAAUCAAAGUUAUUAUUAAAUAAUAUUGAUUUUGGAUGAAUUUAAUUUUUAAUUAU AUUUUUGAAUUUUAAUUUUAUUAUUUUGAUUUAAUAUUUUUAAAAUAUUAUAUAUUUUAGAUUUAAAUUUGUUGUUUUAU AUUUAGUUUAAUGUUUAUAAAUUGAUAAUUAAUUUGUUUUAUUUUAAAGUUUUUAUGAACUGUGAUUUAUAGUUUAUUAU UUUUAGUUUAAUGUUUAAAUAUUUAACUAGUGAUGGCACAGUUGUUCUAUAUGUACCUAUAAAAAAUAGUAAAAUUAUUU UAAUUAAAUUAAUAAAUAAUUAUUAAACUAAUUUUAUAUUAAUAUUAUGAAAAAUUUAAAAAUUAUUUUUUUUUUUUAAU UUUUAUAUAUUGAAGUAAUAUGUAUUGAAUUGAAUAUUAAAAAUACAAAUUUAAUUUGUAAUUAAUAAAUAUAUUUUAUU UUAAUAGAUGUUUAAUGUUAAUUAAUUUAUUAUUUUAAUAUUUAAUAUUUGUUUAUACAAAAGUAACUUUUUUUGAAUAU AAAGAAUUAUUAUUAUAAAUAUUAUUUUAAAAAUAUAAAAAUAUUGUUAAUAAAAUUAUCAAGUUUCAAAAGCGUUUAUU AAAUGCGUCGGUCUAAGUAUUAUAUUUAAGAUUAUUCUUGUAUAUAGAUUUUUAUUUUAAUAAUUCUACAUAAUUAAAAA UUAACCUCAAAUUAUAUUUAUUAGUAGCAUAGUAAUUUAUUAACUGAUUAUUAAAGCGUUCCAUAGAAAAUUUUAAAAUU AUAACAAUCUAAAUAAAUAAUAAAUUAAAAUAAAAAUUUUAAAAAAAAUUAAAAAAUUAAAAUAGGGCAAGUCCUACUCU CCUUUACAAAGAGAACGUUUAUAUGUAAUUGUAUGUUUGAUUGGGGCAAUACUAUAUCUAUUUAUAUAGAAAAAGAACUA UAUUUAUUGAAAUAAUAAAAGGUUCGAGCAGGUUAACAAGCAUUAAUACUAAAUGUGUUUCAUCGUCUACUUAUUGCUAA AUUAUAAUUGAUUGUUCAUCAAAAAAGCAAUUCGUUAGUUGGGUUUUAAAAUCGUUGUAAAGCAGAUUUGUUUAUAUAUU UAAUUUUUGUAUAUAGUUAAAAAUUAAUAUUAGUACGCAAGGAUUCAUUAUUUGUAAUUUAAAUAUAUUAAAUGUUAUUU UAUUAAAUAAAAUAAAAUAAGUCAAUUGUUAUUAUUCAUAUUAAUUUUUUUAAAAGUUUUUUAAUUUUAUAUUAGUUUAU UUGUUUAAAAAGUAUCUAAUUAAUUCAUUAUUUAGGAAUAGUUAAUAAUAAUUUAUAAUUCUGAUUAGAUUUGUUUGUUA AUGCUAUUAAAGGGGUGUGGAAAAAGUGUUAAAUUUUUGAUAUAUUUAAAUAAUAAAUAAAAUAUAACUUAUUAGUCAGA AAUGGAUGCCAGCCGUUGCGGUAAUUUCUAUGCUUUUAAAUAUUAUACAUUUAUUUUAUAAAUUUGUUACUAUAUAUUUU UAGUCAAUAAAACUAAUAAUUAUUUUUAUUUGUUUUUAAACACCGUUUGGUAUAUGCAAAUAAAAAAUGACAUUAAUUAU UAAUUAUAUUAUAUUAUAUUUAUUCAUUUAAGUCAACAAUAUCUAUUUACUGUUUUUGACAACAUGAUAAGGAUUAUAAA UGGUAUUGCAAAUUUUAUAAUCAAAACUAAUUUAUUAUAUUAAAUUAGCAUGUUUAGAUAAAACAAUAAAUUUAGAAGGU AUUGUUGCCCACCAUUCUUUGUAAUAAAGACAACGUGCAGUAAUUAAUGUAUUUAUAAAAAUAUAUUUUUUAAUGUUAAA UUUUCGUUGCCUUUUUUAUUAUUUAGAAAAUUUAUGAAUUUAUACAAAUCAAUAAUGAAAAUUAUAGUAUUAUUAUUUAU GAGGAGAAUUUUCGGAAGGAGGGAUUUUCGGACCAGGAAUGUCCAGAGAGGUUUCGGGCAUCAGCGAUUGAUUUUGGGAG AACGGAGCCGCCGAGUGAAAUUUGCCCAGAGCAGAGUCGGGAGAAGAGUGGAUCGACCGAAGAAAAGACCGUUUUUCGGA AGGGGAGCAGGUCCAACCGAUUUUUUUGCCAACUUGCACAGGAGGGAGCCAGAAGCGCACUCAAAGUUAGUUUUGGGAGA UUUGAAGGGAGAAAUUUCCGAGUUUAUUCAUAUAUUUUUUAGUUUGUGUUAGCAAAUUUUGAAAUACAACUUUUUUGCAA AUUGGAAGAAAACCUCCCAAAUGUAGCUUCCCAAUCUUCCUCUCUAAUCCAUUCCCAACGGUCUUUCCCCCAUCAUCCUC AGAUGUCUCUUCCCCCCCAAAAAAUCCUAAAAAUCCAAGUUCAUCUCGCUCUCUCUCCCCUCAAUUUCCUUAAAAACUCG CUUCCUAAACUUAUCCCGAAAACCCCGCUCUUCUUCCCUCUAAAUCUUUAUCUCCUCCCCUCCAAAUCUCCCUCAAAUCU CUCCUCUCUUCUCCCGAAACUUUAAUCUUUUUAUUUUAUAAAUAAAUUUGGUAUUUAAAAUAUUAUAAUUAAAUAUUCUA AAUUAUUUAAUAAUAUUAGAAAUGAAUACUUUAUUAAAAUAAUAUUAAUGUGUAAUAUAUUUAAUCAUAUUAGAAUUCCG UUUAAAUUGAAAUAUAUUGAAUUGUAAUUAUCAAUACAAUAUAAGUUAUUAAAUAAUAAUUUAAUUUUAUAUGUUUUAUA AUUGUAAUUAUUUAGUUUUGAAAGUUUAUAUAUAAACAAGAUAUAACCUUUUUAUUUUUUAAUACAAUUUUAAAUGAAAU UUAUGAUUUAUUAUUAUUAAAUAUUACUGGCAGACUACAUGAAAAAUAUAAAAAGGCAUUUGUAUAGGUUUACUUUUGGA CCUCAACAUCCUGCAGCUCAUGGCGUUUUAUGUUGUUUAUUAUAUCUUUCUGGAGAAUAUAUAGUUUAUAUUGAUGUAAU AAUUGGUUAUUUGCAUCGUGGUACAGAAAAGUUAUGUGAAUAUAAAACUGUAGAACAGUGUUUACCGAUGAAGACUGGAU UAUGUGAGUGUCGUUUGCAACGAGCAUUUACUGUCAUUGUGUUUUGAGUAUAUGUUGAGGUGUUGUCUUGCUAUUCGCUG UGCAUUUAUGCGUUUAUUAAUGUGUGAGUUUACGCGUUGUUUCAAUGGACUUCUUUGUUGCUCUUGUAUGGUUAUGGAUA UAGGAUCAUUGUCGCCAAUGCUUUGAUCGUUUGAAGAACGUGAUAAGUUGAUGACUUUUUUUGAUUUGUGUUGUGGUUGU AGAAUGCAUUUAGCAUUUAUGUGCUUAUUAGGUUUACUUGAUGAUUUUGUAUUUGGGUUUAUAGAUUUUUUAUUGAUGUU GUGUAUAUCAUGUUUAUUUGUUUUAGAUUUAUAUGAUUUGCUUUUUAUUGGAAAUAGACUUUUAUAUUUGCGUUUGCGCG GGUUAGCAUUUUUUGAUGUUUUUGAUUUAUGUUUUAAUAGUAUAAGUGGUUGUUUGUCUAGAUCGUUGGGUAUGGUAUGA GAUGUUAGAUUAUAUAGUUGUUACGAAUUAUAUUUUAUGUUAGUUUUUGAUUAUUGUUUUUGUUAUUUAGGUGAUGCAUU UGAUAGACUUUUUUUGCGACUUUUUGAUAUGCGUAUGAGUAUACUUCUAUGUAAACAAUGCUUUUUUGUAGGUUUUUUUG UCUUUGGAUUUGUGUGUUUAUUUGAUUAUAUGUAUGUUGAUGUAACUAUAGAAACUAUAAUUAGUUUAUUUUAUAGUUUA UGAUGUUGCAUAUUACCAGGAUGUUCAUUUGCUAAUGUUGAACAUCCUAAAGGCGAAUACAGUAUUUUUUUAUGUUUUUU AUAUGGAUUUAUAUCACGUUUACGUAUACGUUGUGCAGAUUUUGUGCAUAUUUGUUUAUUAGAUGUGAUGAUGCGAGGGU UUAUGUUGCACGACUUAGUAGCAGUUAUUGGUAAUGUUGAUGUUGUUUUUGGUUCUGUAGAUCGAUAAGCUAUUUAUUUA UAUACAAAAAUGAAAGAUGAAUCUAAAAAUUGGUGCGGAGGGGUUUGAUUUUUGUUGGGGUUCUGUCUUACCUGCUAUUU GUAUAGUUUAUUUAACUUUUUGUUUAUGUGGAUUAUUUUGUAUUAUGUUUGGUAGUUUUGUUUUUAUUGAUUAUUGUUUU AUUUGUUUUUUUUCUUGUCUUGUAUUUUGUUUAGUAUGCUUGUUGUGCGAUUUAUUUGUAGAUUCAUUACGGGGUUUGUU UGAUGUUUGUUGUUUUAUACGUUGUAUUCAAUAUUGUUUUGUAUGGUUUAUAAUUAGUGAAUUACUUCUUUUUUUAUCUU UAUUUUAUGUAGUUUUCAGUUUAGUUUUAUUUGUGAGUGUUGAAUUUGCAUUUGUAUUUGUUAUGCCUAUUAUGUUUAGU UGUUUAAUUUGUGAUUUUGGUUUUGUAUUUUAUUGAUAUUUUAUUGAUAUUUUUAAUUUAUUAAUUAAUACAUUUUUAUU AUUUGUAAGUGGUUUAUUUGUUAAUUUUGUUUUAUUUUUAUUUUGAUUUCGUUUUUUUUUAUGUGUUUUAUUUAUGUUAU GAGUCGGUAUAUUAUUUGGCUUUUUGUUUAUGUGAAAUCAAGUUUGAGAGUUUUCAUUAUUAUUUGUGACUUGUAGUUGU GGCGUAUUUGGAUCAAUACUUUUUUUAAUCGAUUUAUUGCAUUUUAGUCAUGUCUUUUUAGGUAUAUUUUUGUUAUUUUU AUGUUUUAGUCGUUGUUUUAAUUUUUUAUGUAUGGAUACACGUUUUGUAUUUCUAUAUGUAGUGUGCCUAUAUUGGCAUU UUGUUGAUUGCGUUUGAUUUUUUUUAUUACGAUUUGUAUAUUUUGAUGUUUUAAGUGUGGUUUACUUAUAUGCAUAAAGG CUCAAUUUUGAAUUUUUAAAUUUUAUUCUAAAAAGCGGAGAGGAAAGAAAAGGCUUUUAACUUCAGGUUGUUUAUUGCGU AUUUAUGGUGUGGGUUUUAGUUUAGGUUUUUUUAUUUGUAUGCAGAUAAUUUGUGGUGUGUGUUUAGCAUGAUUAUUUUU UAGUUGUUUUAUAUGUACUAAUUGAUAUUUUGUUUUAUUUUUGUGAGAUUUUGAUUUGGGAUUUGUAAUACGAAGCACAC AUAUUUGUUUUACAUCGUUGUUAUUUUUUCUUCUUUAUGUUCAUAUAUUUAAGUGUAUAGUAUUAAUAAUUUUAUUUGAU ACACAUAUUUUAGUAUGGGUGGUAGGUUUUGUGAUAUAUAUAUUUAUAGUAAUAAUAGGUUUUAUUGGCUAUGUUUUACC AUGUACAAUGAUGUCGUAUUGGGGUUUAACAGUGUUCAGUAACAUUUUAGCAACUGUCCCAGUUAUUGGUACUUGACUUU GUUAUUGAAUAUGAGGUAGUGAGUAUAUUAAUGAUUUUACAUUGUUAAAAUUACAUGUGUUGCAUGUGCUAUUACCUUUU GUAUUAAUACUUGUAAUAUUUAUGCAUUUGUUUUGUUUACAUUAUUUUAUGAGUUCAGAUGGUUUUUGUGAUCGAUUUGC AUUUUAUUGCGAACGUUUAUGUUUUUGUAUGUGAUUUUAUUUACGAGAUAUGUUUUUGGCUUUUUUGAUAUUAUUUUUUG UAAUUUAUUUUAUUUUUAUAAAUUGAUAUUUUGUUUUUCAUGAAGAAUCUUGAGUUAUAGUUGAUACAUUAAAAACAUCU GAUAAGAUUCUUCCUGAGUGAUUUUUUUUAUUUUUAUUUGGUUUUUUAAAAGCUGUACCAGAUAAAUUUACUGGUUUAUU AUUAAUGGUUAUUUUAUUAUUUUCCUUAUUUUUGUUUAUAUUAAAUUGCAUAUUAUGAUUUGUUUAUUGUAGAAGUUCAU UGUUGUGAUUUACAUAUUCAUUAGUUUUAUUUUAUAGUAUAUUUAUGAGUGGUUUUUUAGCACUGUAUGUUAUAUUAGCA UAUCCUAUAUGAAUGGAAUUACAAUUUUGAGUGUUGCUUUUGUUUAUGUUAGUUGUAUGUAGAUUAGAUUAAAAAUUUAU AUAUUUUUUAUUAAGCGUUAAUAUAUUAAAUUUUAUUUAGAAUAGUAUUAAUAAUCAAAGGGUUGGAAGAAAUUUGCGAA AGAAAGGGAUCUUAGAAAGGAAAUUUUAGUUUAAGACCGAGAAGGGGAGAAGGGAGAGAGAGAUUCGUGUUAUUUAAUUU UUAUGGAUUAAUUGCGUAUUACUGUAUAACAUAUUUAAAUGUCUAUAUUUUAUUUUGUAUUGUAUUUAUGUAUUAUAUGG CUUUUUUAUUUUGUUUUUGCAUUUUAUUAGAUUUUAUAUUAUUUGGAAGUCUUUUAGUAGGAGAUGCGUUUAUGGAUGUU UUUUUUUUACGUUAUCUAUUAUGCUUUUUGGAGUGUUUUUCAUUAUUAUGUAGAUGUAUAUCUACUUUUUUACGAAUGUU UUGUAAUCUUUUGUCUUCGCAUUUUUUGAUGCUUAUGUUUUGUGAUUUUGUAUAUUUUUUUAUUGUAUUUCUAUUAUUUU UUUUAAUGUGUGAUAUUAUUUAUUUUAUGAUAUUUUCAUUCGCCAUGCUAUUUUGCAUAAUAUUUUAUUUAUUUUUAUAU GCAUUAGAUAUGUUUUGCGCAUUAUUACAAAUAUUUAUAUUUUGUAAUAUGAUAAUGCAAUUAAUCAUGGAUUUUUUAUU GUUAUUAAUUUUUCAUUAAUUUAUAGAAUUAAAUCGAAUAAGUUAAUUAUAUCAAAAAAUAGUAUAAAUAUACUACAACU UAAUAUAAAAAAUAGGUUUGAAAAUCGCACAGUAUGUAAUCGUACAACUCAGAAUCCUAUAAAUUGAUAAGAAAAUAUAA AGAUGUUAAUUAUUAGUCUAAAAUAAAAAAUAUAAAUAAUAACCAACCAUAUUAUUGAAAAGAAAAUAAUACAAAUUCCC AUAUAACUUAAGUGAAGUAGUAAACAAAAUACUUUUAAAAAAAAACCAAAUACUAUUGGAAUAGCACCAAUACAUAAAAA AAUACUUGCUAAUAAUACACUAAUUAAUAAAUUAUUAAAAAAGCUAAAAAAAAUAAAGUUAAUUAAAAAAUAAUUUUCAU UAUAUUUAAUAUCGAACAUAUUAUAUACUAUAAAAAAAUAAUAUAAAAUUAUUAAUAUAAUCAGACUUAAUGAGUAAAUU AAAUGAAAAUUUAGAUACAUAUAAAAGAUGUAAUUUUUAUUAGAAAUAAAUAUUAAAAAUAAAAAACUAAAAUUAUUAAC GCUAAGUACAAAUAAAAGACUUACAAUUGCAAAACUAUUUAAUCCAAUUAACACGCAUGUAAUGCAUUGUAUUAUAAUAA GUUUUAUAAAUAUUAUAUAAAAGUAAAUAAAGCAAAUAAGCAAAAUAAUAAGUAUAAAGCAAAAUAAGACAUAAAAUGUU AGCAUGUAGAUAAAUAUAAACACUCCAAGCCGAAUGUAUAAUUGUUCUAAAAAUAAAAUCAAUAUUGCAAUAUAUAAUUU AAAUAAUAUAAGUAAUAUAUAAAAUAAGCAUAAUAUACCUAAUCAUUCUUCAUCAAAUAUUAGAAAACAAAAAUCACAGA GAUAAAAACAGUAAUUUAGUAACAUAUAAUAUAGCAAGACAAAUAAUAAUAUAAAGUUUAUUAAAUUUAUCAUAUAAUAA UAUCAUAAUAUUAGUAUUUUAUAACCGAAUCUACUUGAUAUUAAUAUAAGAAAAAGUAAUAAGCUAAAUAAUUCAAAUAG UAUUGAAAUAAAAAGUAUAUGUAUUACAUUUAAAAACAUAAAAAUUAUUAUAUAUUGUAUAAUUAUUAUCAUGAAUACGA AUCUAGUAUCAAAGUUUAAAAAACAAAAAAGAAAAAAAAAGCAAAAUAAAAAAAGUAGUAAAAAGAUAAAGCAUAUAUAU GAGUCUAAAAUUGUUAGUAUUAUUAUGUUAAUAAUUACAAUUCAUAUUAAAUCAAAUGAUAAAUAAAAAAGUGAAUUAUA AUCACAUAAGAUAAUAAAACUAUAAAGUAAUAAAAAUAAUAUUAUAUGUAUUAAGUAUAGAAACAGAAGGAUUUCGAAAG GAGAGGACAGUUUAAGGAUUUUGAGGAGAAAUUUCGAGGGGAAAGGGGGGAACCAGAAGAACAUAGAAGUCAGUUUUCGA UAUUAAAAUAAUAUAGCAAUUAUUUUUGUAGUGAACAGUCAAAUAAAAGUAAGAACGCACAUGUAGAAUAAAAAAAUAAG UAUAAAUGCUUGCGCUGUUGUAAUUUUUAGUCUAUAACCAAUUACCCUUGGAUAAAAAAACCCAAUAAUUAAGAUAAUUA UAGCUUUAAAACAUAUAAAUAAGCCCCCAAAACAGAGACUGGCUAAUAAUAAUGUUGUCAGUAACACAUGAUUUAUUUCA AGAACGGAAUAUAAUAUAAAAAAGAAUCCUGAUAGUUCUGUAAUCAACCCAGCGACUAAUUCACUUUCACAUUCCAUAUA GUCGAAUGGUAGUUUUAAUCCGUCUAGAAGCAUACUUAUUCAAAAUAUACAUACAAAUAAGAUGCCGGCAAUAUAAAAGU UUGUAAUAUAAAUCUGCCCAACACAAAUGUCUUUAAUGCAAAAAAAGCUAAAGUAGUCUAACGAAUAUACAGUUGUGUAU AAUAAAAAUAAGCCACUUUCAGAAAUAAUACUAAAAAACAUAGUGCGCAUUGCAGAAAGAUAUACAAAGCAACUAGAGAA UAAAAAGCAACCUACAAAAAAUGUGCUAAACAUAUUACUGAAAACAUGUACGCACAUCAUUAUUGUAAUAGUGAAUCCUG UGUCUAAUAACAGUAUAAAACCUAUAGGAAAAUAAAACCAACCAAUAAAAAUGCAGCAUGUAGUAAUUAACAUUGCACCU AUUAAGUAAAUGAUUUCAAAACUAAUUACAAAAAUGAUAAAUUUAAUAAAAAGUUUUAUUCCGUCAGUUAUUGGUGUUAA AAUUCCAAAAAAACAAAGGGCCGGACCUAUUCGUAUUUGAACUAAAGCUAAAAUUCUUCUUUCACAAAGACUUACAAAGC CGGUCAAGACAAGAACAACUAAAAUGUCAAUAAUAAUAAUGAUAAUAAUAUCUAUAUUUAACAUUUUUAAUUAUGGCUUU UAUUUUAUCAUUUUGAAUGAUUUUUUUACUGGAUUCUGUAAUUGUUUUAUUAUCUUUUGUGUGUUUUGUAUGUAUAUGGA UAUGCGCUUUAUUAUUUUCAGCAUGUUUAUUAGUGUCGAAAUUAAAUAAUGUUUAUUGUACUUGGGAUUUCACGGCAUCU AAGUUUAUUGAUGUGUAUUGAUUCAUUAUUGGAGGUAUGUUUUCAUUAGGACUUUUACUUAGGUUAUGUUUGUUAUUAUA UUUUGGUCAUUUAAAUUUUGUUAGUUUUGAUUUAUGCAAAGUUGUUGGAUUUCAAUGGUAUUGAGUCUAUUUUAUUUUUG GAGAAACAACAAUAUUUAGUAAUUUAAUUUUGGAAAGUGAUUAUAUGAUUGGUGAUUUACGUUUAUUACAGUGUAAUCAU GUUUUAACUUUAUUAAGUUUAGUUAUAUAUAAAUUAUGAUUAUCUGCUGUUGAUGUUAUACAUUCAUUUGCAAUUUCAAG UUUAGGUAUUAAAGUAGAGAACCUGGUCGUUGUAAUGAAAUAGUUUUAUUUUCAUCAAAUAAUGCUACAGUGUAUGGGCA AUGUAGUGAACUUUGUGGUGUAUUACAUGGAUUUAUGCCAAUAGUGAUUUGUUUUAUAUAGGUAUAUAAUCUAUAUCAUA AUAUUAGGGGAAAGAAGGACUGAGUCGAAUAUUUGAUUUAUUAUGUAUUAGGAGUUAUGAUUUUAUAUUAUGAUGAUUUG AUUUAGACUUUAUUUUAUAUGAUUUCGUUUUUGAUUUUGUAGUGUGUAUAACUUUUAUUUUUGUGUUUGUCUUAGGUUUU UUUCUUAGAAUAUUUUUUAGUUUUGUAUUUGUGUUAUUAUUUAUAGUUUUUUUUGGUUUAUUUAUGCUUACGUUUAUGUA UAUAGGUUAUUUUAUAUAUUAUAUUUAUAUAUUAUAUAAUUUUAUAUGUUAUUUUUUUUGUUUUAGUAUUUCGUAUUUAU UAUAUUAUAUUGAGUUUUUUACAUAUUUAUUAUGUUUUAUAUUUAUAGAUUUUAUAUCGUUUUCUAUCCAUUUAAUUUCU UAUUUUGGCAUUAUUUAUAUAUUUAAUGUUAUAUUUUGUUCGUAUUUAUUUUGUCUAUUUUAUUUUAUAAUUUGUUUUAU AUUUUGUUUUAUAUUUUUUGUUAUUCGAUGUUUAUUUAUAAUAGUUUAUGAUUUUUUGUUUUUUAAUUUUGAUAUAUAUU UAUCAUUUUUAAUGUGUGAUAUGUUGUAUAUCGAUUAUAUAUGUUUUUUAUUGAUAUAUUUUGGUUUUAUAUUUUCAUUU AUAUUAGGCUUUUUUUGUUUUAUAUUUGUUUUAAAUUAUGUUUUUUUAGUAUUAUUUUUUGUCUUGGCGUUAUUUUUUGG GUUUUUAUUUUUAUCAUAUGGUAUUUUUAUAUUUUUUAUUUAUUAUUUUUUUUGAUUAUUCGUUAUAUAUAGUCGUACAU GUUUUACAUUAGUGCAAUCGGUAAUUAUAUUUUUUAAAUUUUUAUACUUUGAUGUUUUUUUUAUAUUUAUAUUUUUAUUG AUAUUGUUUAUUAUUUGUUUUUUUGGUUUCUUUUUAAAAGAUUUUUUAUUUUUGAAUUUUUUUUUUGAUAUGUUUAUUGU AUUAAUAAGUUAUGAUGUGAAUAAUUAUUGUGCAUUUUAUAAUCAUUAUCAACAGUUUUGUGUUACUCAAUUAUUGUCUA UUUAUAUGUAAAAAAAUAAAAAUAAAGAUUGUCAAAAAUAUAUAAAAAAAACAAAGCAGAAACACAAUAUUAAAAACAGG UAGUCUAAAACUAUAUGCGCAAAGUCAACUAGUAAUAAAUAUAAAACCAUUACACAAGGUAUUCAGGUUGAGAAGUAGAA AAAGCAGUAUAGGCUGAAUACGAAUAGAUUAACAAAGAAUAAACAAUAGUCUCAAAAUAAAAACACACAGAACAGUGCGC AUAAAAACAAAAUUAAGCUUGCUAAUAAUAGCAUUCCGUAGAGCAUGAAUGAACUUCAAAAUAAAAAUGACACAGGAUAG UCAGAUAUUCUACGAGGAAAUGCAUACAUACCUAAACUAUGCAUUGGGAAAAAAACCAUAUUAGAUCCUAUAAAAAGCGU ACUAAUAAAGUAAAACAUUCAGAAUAAAUAUAAUUCUAUAGGUAGUCAUUUUGCAAGAAAGUGAAUAAAUCCUGCAAGAA AUCCAACAACAGCACCUAAAGAUAAAACGUAGUGAAAGUGACCGACUACAAAGUAUGUGUCAUGUAACAUGAUGUCUAUA CCAACAUUCGCCAAAAAAAGCCCUGUUACAGCACCAGACAAAAACAUAAAAAUAAACAUUAUAACAAAAUAUAUCUCAAA UGUAAUUAUAAUAUCUGUAUAAAUAAAACUAUAGAUCCAAUUGAAUAGCUUGACACAUGUGGGUAGGCCAAUCAAAAUAG AUACUCCACCAAAAUAUGCUCUAGAAUCAACAUCCAUCCCUACAACAAACAUGUGAUGCGCUCACACAAACAUACCUAAG AUCGCAAUUAAUAUCAUUGAAUAUAUCAUUGCAACCGCACUGAACACACAGCGAAAUCCGACUAUUUCAAUAAUAGUAGA GAUAAGACCAAAUACAGGUAAUAAUAUUAUAUAAACUUCAGGAUGACCAAAAAAUCAAAACAGGUGUUGAAAUAGAAUCA AGUCACCACCACCAACAACAUCAUAAAAUGAAGUAUUAAAGUUUCUGUCACAUAAAAUCAAGGUCACACCUCCCGCUAAU ACUGGUAAAGUUAUUAUUAACAAAAUAGCAGUUAUAAGCGCAGCUCAAAUAAAUAGCGAUCACGAUAAAAAACUAAAGAA UUUUCUACGACAGCAAAAUACAGUACCAAGUAAAUUUAUAGAGUUUAAAAUACUUGAUACACCUAAUAGAUGAACCGCAA ACAUAACAAAGUCACAAGCCAAACUUGAAUGAAAGUCUAUACAUAUUAAAGUAGGAUAUAGCGUCCAACCCACACCCAUA CCUUCCUCAGUCAAAAAACCGCUUACAACACAGCCAAAUCCGGCCAAGUACAUUCAAAAACUCAUGUUGUUUAAACGUGG AAAAACCAUAUCGGGAAAACCUGCCAUAACAGGAAUAAAGUAGUUCACAAGACCUCCCAUCAUAACAGGCAUUAUAAACG CAAAAACCAUUAUCAAUCCAUGCGAGGUAAUUAAAACGUUAUAAAACUGGUAAUCUCCAAACAAAACACCACAUCCUAUA AUAGAAAGUUCAAGUCUAAUAAAUAGUGAAUAAACAUAUCCAACGAAUCCUGAUAGGAUUGCAACUAAGAGAUAACACAA ACCAAUCAUUUUAUGCGAAACACUUAAACACACCAAACAAAGUCAAAACAUUUUCAAUAUAAAAAAUUUAAAUUUAAUUU GUUUGAUUUUAUAUAUAGUAAUAAUCCAAUCAAUUUUCGCUCUCGCCUUUCUCCCACCCCCUUCUGCUUUCUUCCCUCCA ACCUCUCUUCUUCCCCUCCCUACCUUUCUUCCCCUUCUAUUUCAGUUCCUUCUCCCCCUCCCUCCUAAUCCCUGCUCUUC CAAAGUCUCUCUUUCUUCCCCUAAAGUCUUUCCCUGCUUUCUAAUUUACUGAUUAAAAUAGUAUACGUGCUUGGUUAAUG UGUAUUGACUUCAGUCAAAAUAUAAAAGUAGAGCUAGAUUAAAGUAACUAAAUAAUAAAAUUUAAUAGAUGUUUAAGUUU AUAUUGAUUACUUUGAUUUUUUUGUUAUUAUUUUUAAUAGUCAUAUUUAUAUUUAUUAAUUAUAGUUUUUGUUUAGCAUU GCAAUUAAAUUAUGUUUAUAUAAAUAUAUAUCUAAAUUAUAUUAGUCUAUGAUUUAUUUUUUUCAUGGGAGUUAUUGUAU AUUUUCUUGUUUUUCUUUUGUCACGUAAGUUAGUGUCUUACACAAAAUAUUUUUAUGUUUUAUGCUCGUAUUUAUUUAUA UUUUUUGAUGUUGUAUUUAUAAUUUUAAUAGAUGACUUUAUGUGUUUUAUGAUUUUAUUUGAAAGUUUAUUUUUUCCAAU UUGUUUUGUAAGUUUAUUUUUUAAUUUUAAUAAUAGAUUUAUAUUUGCUAUAUUUUAUUUGGUAGUAUUUAGUUCCUUAA GCUCAAUAAUGUGUAUUAUGAUUUGUAUAUUAAUUAUUUUUCAUUUUAAUGUUUUGAGUCUGCAUAGUUUUGUUGAUGUG UGUAUUUUUGAUAGUUUAUACUUAGGUAUGUAUAUAUGAGUGUUAUUAUUUAUAAUGUUUGCUAUUAAGUAUCCAAUCUG ACCAAUGCAUGUAUGAUUACCAGAAAUGCAUGUAGAAGUCAAUACUGAAUUAAGUGUGUUGUUAGCAAGUGUUGUGUUAA AAAUAGGUUUUUUCGGUCUUUAUAAAUUUUUAUUUUUGAGUUUUAAUCAACUUUCGUUAUGGUUUUUAGGUUUUGUGGAU UGUUUAGUGAUGUUAGGUUUGACAUUUUUGGCUAUUACGUUAUUAUUUUUGAGUGAUUAUAAAAAAAUAAUCGCAAAUUG GUCUGUUAUACAUACGGGUAUAGCCUUAAUUUUAUUGUGACAUAACGAUAUAUUGUUUUUAGGUUUAUUGAUUUUUUGUA AUUUAUCACAUAUAAUAAGUUCUGCAUUAAUGUUUAUAAUGGUCGGAUAUAUGUAUGAUAAUUAUGGUAUUCGAAUAUUU UUAUUAUUGGUGUCUUUUUUUGGUAUUAGUUUGUGGAGUUCAUUAUUUUUAGGGAUUUUUUUAUUUAAUAUAGAUUUCCC AUUUAUGCUGUUAUUUUAUGUUGAUAUAUUUUUAUUGUAUGGGCUAAUUUCAUUAUCAUUUGUAUAUAUUUGUUGUUUUU ACAUAAUAAUAUUAGCAAUAUUUCUAUCAUCGAUAUAUAUAUAUAUAUGCUUAAGUUUUUAUUCUUUUAUAUGAGUAGAU AAAUACUUACGUUUAGAUUUAACAAUAAAUGAUAUUUAUCUAUAUUUUGUUAUAAGCGUGAUGGUUAUUUUUCUAUUUUA UUUAAUUUAUUUGUUAUUUUAAUUAAUUUUAUUACACUAUUUUUUUUUCCGUCCAGAUCUUUUAACAAAUCCCAUUCUCC CCCCUUUUCCUUCCCCCCUUUUUUAAAACCUUAAAAGUCCCCUUCUGCGAACUUCUUAUGUCUCGUGUUCUGUCUCCCCU GUCUCCCGCUCUGCCCUCUUUCCCUCUUUUCCAAACUAAUCCUAUUGACCUUUAAUCUAAAGUUAAAAACGUGAAUUUUU GAGUGAGUUGCUUUUUGUUAUUUUAGGGAAAAGCCACGAACCAAGCUCCGGAACCGACGGAAUUGCAAAGAAGAAAAGAA AUUUUGUAUGCUUUUGGGGAUCCUAGUUGAAGGAAUUUUGGGGGGAGAGCCAGGAGAAAGAUUUCACGGAAUUUGUUUUC GUAAGCUAAAUUAUAAAUUUUAAUAUUAUAAGUAUUUAAUAUUCGACUUUAUUUUUAUAUUCAGAAUUAAAAAUGUUUAU GUUUUUUUUUAUGUUUUUUUUCAUGUUUGGAUUUGUUUGUGGUAUAUUUUUUGUUGGAAGGCAUAUGUUAAGUUUUUGAU UAUCAAUAGUUUUAUGUGUUUUUUUAGUUUUAUCUGUACUAUUUAGUUGUUUUUGUCUUAGUGUAUGUAUAUAUGGGUAC UGCUUUUAUGAUUUUUGUUUAAUUUUAAUUUUAGACUUUUGUUUUGUUUGAUUAACUUUUUAUUGUAAUGGUUUUUAUAU AUUUAUUUUAUAUUUAAUUGAUAUUGUGUUUUGUUUUAUAGUUUUUUAUGCAUUCUAUUAUAUGUAUUUUGAUGUAAUGU UAGCCCGUUUUUUCCAUAUAUUUUGAUGAUUUGUUUUGUGUAUGAAUUUUUUUAUAUUGUCGUAUGACUUUUUAACAGCU UAUUGUGGUUGAGAGUUGUUAGGUUUAUUUUCAUUUUUUUUGAUAUCAUAUUUUUGAUAUAGAUUUUAUGCGUUAAAAUU UGCUUUUAAAGCUUUUUUCAUAAGUAAAAUAGGCGAUGUUUUGCUAUUAUUAGCAUUUACAAUAUCAUUUUUAAUAAAUG GCUAUUGUGUGAUUACAUUUUAUUUUUUAUCGUUUUUAUGUGUGGAUUAUGUUUUAUUAUUGUUUAUAAUAAUUUUAUUA UUAUUGUGUGGUUUUACUAAGUCUACUCAAUUUGGUUUACAUAUUUGACUGCCAGAUGCAAUGGAAGGACCAAUCCCAGU GUCUGCACUAAUUCAUGCUGCAACAUUAGUUGUAUGUGGUAUUAUAUUGGUUAGUUUUAUUUUUUGAUGUUUUGAUUUUU GAUUUUGUUAUUUUUAUGGAUUGCUUGGUUGAGCUAGUUUGAUUUUAGUAAUGAUGAGUUUAUGUGUUUUUUAUAAUUUU GAUGUAAAAAGGUAUGUUGCAUUUAGUACUAUAUGCCAAAUAAGUUUUUCUAUGUUUUGUUGUUUAUGUCUAGAUCUAUA UGUAGGUUGUUUAAUUUUUUGUUAUCAUAUGUUUUAUAAAGCAACUUUAUUUAUUGUGCUAGGUGUUUGAAUUCAUUUUU UUUUUGGAUUGCAGGAUAUACGUUGUUAUUUUUUUACAUAUUUUUGUGGUUGUAUUUUAGCACGUAUGUUAUUGAUAUUU GCUUUGUUAAACUCAUGUUCAUUAUGAUUUUUGUGUGGAUUUUAUUGUAAAGAUCUUCUUUUAUGUAUGUUAAUGUUAAC AUCAUUUUUUUUUAUAUUAGAGUUUUUGUGUGUGUGUAUAUUUUUUAUAUUUUUUACUGUGUUAUAUAAUUAUUUUUUGU UAUUUUUUUUGUGUUUUGUAUUUAAAUGCUUUUGUUUAAUUGAUACACUUUUUUUAAUUUUUGAUUUUGAAUGCUGUCUU GUAUAUUGUACAUUUUGUUUAUAUAUGUGUUUUAUACUAAUUUUUUUUGUUUUAGAUUUUUUAUAUGUUUUUAUUUUUUC AAGUUAUUGCUUAUUUUGAUCUUUUUAUUUAUAUUAUAUGUCUUUUUUUGAUAUUGCGAUAUUUACUAUAUUUGUAAUGA UUUCAUUAAGUUUUGUAUAUUAUGGUUGUAUUAUAUUUUAUUUUUUUAAUAUUGAUUGUAUUAUGUUUUUUUGACGAAUA UUUUUGUUUAUAACUGUCGGAUUUUUAUUUUUUAUAUUUUCGGUAUGAUAUUUUAUUUGUUUUUAUAUAUAUAUAUUUAU GUUUGUGUGAAAUAUUGUUAUAUAUUUUAGAUAUAAUUUAAAGUAUUGUUUAUUUUUUUGUAUGUUAUUUAUAAUAUACA UUUAGUAGAGCUAUGCAAAUUUAAUUUUGAAUUAAAUUCAGUCUAUCAGAGUAUAUUUUAUUUAGAAAUUUAUAUUAUCU UUUAACUCCAAGUUUUUUAAGUAGUGUUUUGCUAUUUUUUGUUAGAAUAUUAAUUGUAAAAUACAUAAUUUAUCUAAAUA AUUAAUUAAUGAAAAGUAACUAAGACAAAAAAUGGUAUAAAAAGUAAAAUAAGUAUUAUAGAUAAUAGUUAAUUUUUAAU UUUAUUAUGCAAGCACAACGAAUUUAUUUUUAGUAAUAAUACGCCAAUAUGUUAUAUUUCCUGCCCAAUGAUUGUAUGAA CAAUUUUUGUAUGAUAAAUAAGUCGCCCACACCACGAAAUAACAAAUUUUUGCACGCCACAACAAAUUUAUGAACGAGUU UCUGUAUGCCACAACAAAUUUAUGAACGAGUUUCUGUAUGCCACAACAAAUUUAUGAACGAGUUUCUGUAUGCCACAACA AAUUUAUGAACGAGUUUUUGUAUGCCACAACAAAUUUAUGAACUCUGUAUGCCACAACAAAUUUAUGAACGAAUUUCUGU AUGCCACAACAAAUUUAUGAACGAGUUUCUGUAUGCCACAACAAAUUUAUGAACGAGUUUCUGUAUGCCACAACAAAUUU AUGAACAAGUUUCUGUAUGACACAACAAAUUUAUGAACGAGUUUCUGUAUGACACAACAAAUUUAUGAACUCUGUAUGCC ACAACAAAUUUAUGAACGAGUUUCUGUAUGCCACAACAAAUUUAUGAACGAGUUUCUGUAUGCCACAACAAAUUUAUGAA CGAGUUUCUGUAUGCCACAACAAAUUUAUGAACGAGUUUCUGUAUGCCACAACAAAUUUAUGAACUCUGUAUGCCACAAC AAAUUUAUGAACGAAUUUCUGUAUGCCACAACAAAUUUAUGAACGAGUUUUUGUAUGCCACAACAAAUUUAUGAACAAGU UUCUGUAUGACACAACAAAUUUAUGAACGAGUUUCUGUAUGCCACGAACAAAUUUAUGAACGAGUUUCUGUAUGACACAA CAAAUUUAUGAACGAGUUUCUGUAUGACACAACAAAUUUAUGAACGAGUUUCUGUAUGACACAACAAAUUUAUGAAUGAG UUUCUGUAUGACACAACAAAUUUAUGAACGAGUUUCUGUAUGCCACGAUAAACAUAUUUAUAUUAUAUUAUAUUAUAUUA UAUUAUAUUAUAUUAUAUUAUAUUAUAUUAUAUUAUAUUAUUAUAUUAUAUUAUAUUAUAUUAUAUUAUAUUAUUUAUAU UAUUAUAUUAUUAUAUUAUAUUAUAUUAUAUUAUAUUAUAUUAUAUUAUAUUAUAUUAUAUAUUAUUAUAUUAUUAUAUU AUUAUUAUAUUAUUAUAUUAUCAUUAUUAUUAGAAUAUUUACUAAUAUAUAUAUAUAUCUAUAUCAAGCUUGUUAGAAAA AACUAUGUUUUUUCUAACAAGAUUGAUACUCUCGGUAUGG

R1 [Leishmania tarentolae]

Nucleic-acid type
Name: R1
Theoretical weight (MDa): 0.001
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: AUU

R2 [Leishmania tarentolae]

Nucleic-acid type
Name: R2
Theoretical weight (MDa): 0.011
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU

R5 [Leishmania tarentolae]

Nucleic-acid type
Name: R5
Theoretical weight (MDa): 0.001
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: UUUUU

U8 [Leishmania tarentolae]

Protein type
Name: U8
Theoretical weight (MDa): 0.004
Number of copies: 1

GUANOSINE-5'-TRIPHOSPHATE

Ligand type
Name: GUANOSINE-5'-TRIPHOSPHATE
Theoretical weight (MDa): 0.001
Number of copies: 1

ADENOSINE-5'-TRIPHOSPHATE

Ligand type
Name: ADENOSINE-5'-TRIPHOSPHATE
Theoretical weight (MDa): 0.001
Number of copies: 1