EMD-1172 Function and Biology

Conformational transition of initiation factor 2 from the GTP- to GDP-bound state visualized on the ribosome.

Single particle reconstruction
11.5Å resolution
Overview of EMD-1172
Sample name: Ribosome complex with initiation factor 2 in GTP state
Number of unique components: 4
Oligomeric state: monomer
Theoretical weight (MDa): 2.5

70S [Thermus thermophilus HB8]

Ribosome-prokaryote type
Name: 70S
Alternative name: 70S

messenger RNA [Thermus thermophilus HB8]

Nucleic-acid type
Name: messenger RNA
Alternative name: mRNA
Type: RNA
Structure: SINGLE STRANDED
Synthetic: true
Sequence: GGCAAGGAGGUAAAAAUGAAAAAAAAA

formyl-methionyl-RNA [Thermus thermophilus HB8]

Nucleic-acid type
Name: formyl-methionyl-RNA
Alternative name: fMetRNA
Type: RNA
Structure: DOUBLE HELIX
Synthetic: false
Sequence: CGCGGGGGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGUUCAAAUCCGGCCCCCGCAACCA

initiation factor 2 [Thermus thermophilus HB8]

Protein type
Name: initiation factor 2
Alternative name: IF2
Oligomeric state: monomer
GO: GO:0006413
InterPro: IPR000178
Natural source of the component
Organism: Thermus thermophilus HB8
Cellular location: cytoplasm
Expression system
Expression system: Escherichia coli
Vector: pET30b