EMD-11279 Function and Biology

Human mitochondrial ribosome in complex with mRNA, A/A tRNA and P/P tRNA

Single particle reconstruction
2.59Å resolution
Overview of EMD-11279
Sample name: Ribosome with mRNA and tRNAs
Number of unique components: 97
Details: Mitochondrial ribosome in complex with mRNA, A/A tRNA and P/P tRNA

Ribosome with mRNA and tRNAs [Homo sapiens]

Protein type
Name: Ribosome with mRNA and tRNAs
Theoretical weight (MDa): 2

Large subunit of ribosome [Homo sapiens]

Protein type
Name: Large subunit of ribosome

Small subunit of ribosome [Homo sapiens]

Protein type
Name: Small subunit of ribosome

16S mitochondrial rRNA [Human]

Nucleic-acid type
Name: 16S mitochondrial rRNA
Theoretical weight (MDa): 0.501
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: GCUAAACCUAGCCCCAAACCCACUCCACCUUACUACCAGACAACCUUAGCCAAACCAUUUACCCAAAUAAAGUAUAGGCG AUAGAAAUUGAAACCUGGCGCAAUAGAUAUAGUACCGCAAGGGAAAGAUGAAAAAUUAUAACCAAGCAUAAUAUAGCAAG GACUAACCCCUAUACCUUCUGCAUAAUGAAUUAACUAGAAAUAACUUUGCAAGGAGAGCCAAAGCUAAGACCCCCGAAAC CAGACGAGCUACCUAAGAACAGCUAAAAGAGCACACCCGUCUAUGUAGCAAAAUAGUGGGAAGAUUUAUAGGUAGAGGCG ACAAACCUACCGAGCCUGGUGAUAGCUGGUUGUCCAAGAUAGAAUCUUAGUUCAACUUUAAAUUUGCCCACAGAACCCUC UAAAUCCCCUUGUAAAUUUAACUGUUAGUCCAAAGAGGAACAGCUCUUUGGACACUAGGAAAAAACCUUGUAGAGAGAGU AAAAAAUUUAACACCCAUAGUAGGCCUAAAAGCAGCCACCAAUUAAGAAAGCGUUCAAGCUCAACACCCACUACCUAAAA AAUCCCAAACAUAUAACUGAACUCCUCACACCCAAUUGGACCAAUCUAUCACCCUAUAGAAGAACUAAUGUUAGUAUAAG UAACAUGAAAACAUUCUCCUCCGCAUAAGCCUGCGUCAGAUUAAAACACUGAACUGACAAUUAACAGCCCAAUAUCUACA AUCAACCAACAAGUCAUUAUUACCCUCACUGUCAACCCAACACAGGCAUGCUCAUAAGGAAAGGUUAAAAAAAGUAAAAG GAACUCGGCAAAUCUUACCCCGCCUGUUUACCAAAAACAUCACCUCUAGCAUCACCAGUAUUAGAGGCACCGCCUGCCCA GUGACACAUGUUUAACGGCCGCGGUACCCUAACCGUGCAAAGGUAGCAUAAUCACUUGUUCCUUAAAUAGGGACCUGUAU GAAUGGCUCCACGAGGGUUCAGCUGUCUCUUACUUUUAACCAGUGAAAUUGACCUGCCCGUGAAGAGGCGGGCAUAACAC AGCAAGACGAGAAGACCCUAUGGAGCUUUAAUUUAUUAAUGCAAACAGUACCUAACAAACCCACAGGUCCUAAACUACCA AACCUGCAUUAAAAAUUUCGGUUGGGGCGACCUCGGAGCAGAACCCAACCUCCGAGCAGUACAUGCUAAGACUUCACCAG UCAAAGCGAACUACUAUACUCAAUUGAUCCAAUAACUUGACCAACGGAACAAGUUACCCUAGGGAUAACAGCGCAAUCCU AUUCUAGAGUCCAUAUCAACAAUAGGGUUUACGACCUCGAUGUUGGAUCAGGACAUCCCGAUGGUGCAGCCGCUAUUAAA GGUUCGUUUGUUCAACGAUUAAAGUCCUACGUGAUCUGAGUUCAGACCGGAGUAAUCCAGGUCGGUUUCUAUCUACUUUC AAAUUCCUCCCUGUACGAAAGGACAAGAGAAAUAAGGCCUACUUCACAAAGCGCCUUCCCCCGUAAAUGAUAUCAUCUCA ACUUAGUAUUAUACCCACACCCACCCAAGAACAGGGUUUGU

mitochondrial tRNAVal [Human]

Nucleic-acid type
Name: mitochondrial tRNAVal
Theoretical weight (MDa): 0.023
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: CAGAGUGUAGCUUAACACAAAGCACCCAACUUACACUUAGGAGAUUUCAACUUAACUUGACCGCUCUGACCA

39S ribosomal protein L2, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L2, mitochondrial
Theoretical weight (MDa): 0.033
Number of copies: 1

39S ribosomal protein L3, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L3, mitochondrial
Theoretical weight (MDa): 0.039
Number of copies: 1

39S ribosomal protein L4, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L4, mitochondrial
Theoretical weight (MDa): 0.035
Number of copies: 1

39S ribosomal protein L9, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L9, mitochondrial
Theoretical weight (MDa): 0.03
Number of copies: 1

39S ribosomal protein L10, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L10, mitochondrial
Theoretical weight (MDa): 0.029
Number of copies: 1

39S ribosomal protein L11, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L11, mitochondrial
Theoretical weight (MDa): 0.021
Number of copies: 1

39S ribosomal protein L13, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L13, mitochondrial
Theoretical weight (MDa): 0.021
Number of copies: 1

39S ribosomal protein L14, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L14, mitochondrial
Theoretical weight (MDa): 0.016
Number of copies: 1

39S ribosomal protein L15, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L15, mitochondrial
Theoretical weight (MDa): 0.033
Number of copies: 1

39S ribosomal protein L16, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L16, mitochondrial
Theoretical weight (MDa): 0.028
Number of copies: 1

39S ribosomal protein L17, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L17, mitochondrial
Theoretical weight (MDa): 0.02
Number of copies: 1

39S ribosomal protein L18, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L18, mitochondrial
Theoretical weight (MDa): 0.021
Number of copies: 1

39S ribosomal protein L19, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L19, mitochondrial
Theoretical weight (MDa): 0.034
Number of copies: 1

39S ribosomal protein L20, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L20, mitochondrial
Theoretical weight (MDa): 0.017
Number of copies: 1

39S ribosomal protein L21, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L21, mitochondrial
Theoretical weight (MDa): 0.023
Number of copies: 1

39S ribosomal protein L22, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L22, mitochondrial
Theoretical weight (MDa): 0.024
Number of copies: 1

39S ribosomal protein L23, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L23, mitochondrial
Theoretical weight (MDa): 0.018
Number of copies: 1

39S ribosomal protein L24, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L24, mitochondrial
Theoretical weight (MDa): 0.025
Number of copies: 1

39S ribosomal protein L27, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L27, mitochondrial
Theoretical weight (MDa): 0.016
Number of copies: 1

39S ribosomal protein L28, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L28, mitochondrial
Theoretical weight (MDa): 0.03
Number of copies: 1

39S ribosomal protein L47, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L47, mitochondrial
Theoretical weight (MDa): 0.03
Number of copies: 1

39S ribosomal protein L30, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L30, mitochondrial
Theoretical weight (MDa): 0.019
Number of copies: 1

39S ribosomal protein L32, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L32, mitochondrial
Theoretical weight (MDa): 0.021
Number of copies: 1

39S ribosomal protein L33, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L33, mitochondrial
Theoretical weight (MDa): 0.008
Number of copies: 1

39S ribosomal protein L34, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L34, mitochondrial
Theoretical weight (MDa): 0.01
Number of copies: 1

39S ribosomal protein L35, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L35, mitochondrial
Theoretical weight (MDa): 0.022
Number of copies: 1

39S ribosomal protein L36, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L36, mitochondrial
Theoretical weight (MDa): 0.012
Number of copies: 1

39S ribosomal protein L37, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L37, mitochondrial
Theoretical weight (MDa): 0.048
Number of copies: 1

39S ribosomal protein L38, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L38, mitochondrial
Theoretical weight (MDa): 0.045
Number of copies: 1

39S ribosomal protein L39, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L39, mitochondrial
Theoretical weight (MDa): 0.039
Number of copies: 1

39S ribosomal protein L40, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L40, mitochondrial
Theoretical weight (MDa): 0.025
Number of copies: 1

39S ribosomal protein L41, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L41, mitochondrial
Theoretical weight (MDa): 0.015
Number of copies: 1

39S ribosomal protein L42, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L42, mitochondrial
Theoretical weight (MDa): 0.017
Number of copies: 1

39S ribosomal protein L43, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L43, mitochondrial
Theoretical weight (MDa): 0.023
Number of copies: 1

39S ribosomal protein L44, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L44, mitochondrial
Theoretical weight (MDa): 0.038
Number of copies: 1

39S ribosomal protein L45, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L45, mitochondrial
Theoretical weight (MDa): 0.035
Number of copies: 1

39S ribosomal protein L46, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L46, mitochondrial
Theoretical weight (MDa): 0.032
Number of copies: 1

39S ribosomal protein L48, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L48, mitochondrial
Theoretical weight (MDa): 0.024
Number of copies: 1

39S ribosomal protein L49, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L49, mitochondrial
Theoretical weight (MDa): 0.019
Number of copies: 1

39S ribosomal protein L50, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L50, mitochondrial
Theoretical weight (MDa): 0.018
Number of copies: 1

39S ribosomal protein L51, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L51, mitochondrial
Theoretical weight (MDa): 0.015
Number of copies: 1

39S ribosomal protein L52, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L52, mitochondrial
Theoretical weight (MDa): 0.014
Number of copies: 1

39S ribosomal protein L53, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L53, mitochondrial
Theoretical weight (MDa): 0.012
Number of copies: 1

39S ribosomal protein L54, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L54, mitochondrial
Theoretical weight (MDa): 0.016
Number of copies: 1

39S ribosomal protein L55, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L55, mitochondrial
Theoretical weight (MDa): 0.015
Number of copies: 1

Ribosomal protein 63, mitochondrial [Human]

Protein type
Name: Ribosomal protein 63, mitochondrial
Theoretical weight (MDa): 0.012
Number of copies: 1

Peptidyl-tRNA hydrolase ICT1, mitochondrial [Human]

Protein type
Name: Peptidyl-tRNA hydrolase ICT1, mitochondrial
Theoretical weight (MDa): 0.024
Number of copies: 1

Growth arrest and DNA damage-inducible proteins-interacting protein 1 [Human]

Protein type
Name: Growth arrest and DNA damage-inducible proteins-interacting protein 1
Theoretical weight (MDa): 0.025
Number of copies: 1

39S ribosomal protein S18a, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein S18a, mitochondrial
Theoretical weight (MDa): 0.022
Number of copies: 1

39S ribosomal protein S30, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein S30, mitochondrial
Theoretical weight (MDa): 0.05
Number of copies: 1

39S ribosomal protein L12, mitochondrial [Human]

Protein type
Name: 39S ribosomal protein L12, mitochondrial
Theoretical weight (MDa): 0.021
Number of copies: 6

12S mitochondrial rRNA [Human]

Nucleic-acid type
Name: 12S mitochondrial rRNA
Theoretical weight (MDa): 0.306
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: AUAGGUUUGGUCCUAGCCUUUCUAUUAGCUCUUAGUAAGAUUACACAUGCAAGCAUCCCCGUUCCAGUGAGUUCACCCUC UAAAUCACCACGAUCAAAAGGGACAAGCAUCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCAC GGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGU GCCAGCCACCGCGGUCACACGAUUAACCCAAGUCAAUAGAAGCCGGCGUAAAGAGUGUUUUAGAUCACCCCCUCCCCAAU AAAGCUAAAACUCACCUGAGUUGUAAAAAACUCCAGUUGACACAAAAUAGACUACGAAAGUGGCUUUAACAUAUCUGAAC ACACAAUAGCUAAGACCCAAACUGGGAUUAGAUACCCCACUAUGCUUAGCCCUAAACCUCAACAGUUAAAUCAACAAAAC UGCUCGCCAGAACACUACGAGCCACAGCUUAAAACUCAAAGGACCUGGCGGUGCUUCAUAUCCCUCUAGAGGAGCCUGUU CUGUAAUCGAUAAACCCCGAUCAACCUCACCACCUCUUGCUCAGCCUAUAUACCGCCAUCUUCAGCAAACCCUGAUGAAG GCUACAAAGUAAGCGCAAGUACCCACGUAAAGACGUUAGGUCAAGGUGUAGCCCAUGAGGUGGCAAGAAAUGGGCUACAU UUUCUACCCCAGAAAACUACGAUAGCCCUUAUGAAACUUAAGGGUCGAAGGUGGAUUUAGCAGUAAACUGAGAGUAGAGU GCUUAGUUGAACAGGGCCCUGAAGCGCGUACACACCGCCCGUCACCCUCCUCAAGUAUACUUCAAAGGACAUUUAACUAA AACCCCUACGCAUUUAUAUAGAGGAGACAAGUCGUAACAUGGUAAGUGUACUGGAAAGUGCACUUGGACGAACC

28S ribosomal protein S2, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S2, mitochondrial
Theoretical weight (MDa): 0.033
Number of copies: 1

28S ribosomal protein S24, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S24, mitochondrial
Theoretical weight (MDa): 0.019
Number of copies: 1

28S ribosomal protein S5, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S5, mitochondrial
Theoretical weight (MDa): 0.048
Number of copies: 1

28S ribosomal protein S6, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S6, mitochondrial
Theoretical weight (MDa): 0.014
Number of copies: 1

28S ribosomal protein S7, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S7, mitochondrial
Theoretical weight (MDa): 0.028
Number of copies: 1

28S ribosomal protein S9, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S9, mitochondrial
Theoretical weight (MDa): 0.046
Number of copies: 1

28S ribosomal protein S10, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S10, mitochondrial
Theoretical weight (MDa): 0.023
Number of copies: 1

28S ribosomal protein S11, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S11, mitochondrial
Theoretical weight (MDa): 0.021
Number of copies: 1

28S ribosomal protein S12, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S12, mitochondrial
Theoretical weight (MDa): 0.015
Number of copies: 1

28S ribosomal protein S14, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S14, mitochondrial
Theoretical weight (MDa): 0.015
Number of copies: 1

28S ribosomal protein S15, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S15, mitochondrial
Theoretical weight (MDa): 0.03
Number of copies: 1

28S ribosomal protein S16, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S16, mitochondrial
Theoretical weight (MDa): 0.015
Number of copies: 1

28S ribosomal protein S17, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S17, mitochondrial
Theoretical weight (MDa): 0.015
Number of copies: 1

28S ribosomal protein S18b, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S18b, mitochondrial
Theoretical weight (MDa): 0.029
Number of copies: 1

28S ribosomal protein S18c, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S18c, mitochondrial
Theoretical weight (MDa): 0.016
Number of copies: 1

28S ribosomal protein S21, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S21, mitochondrial
Theoretical weight (MDa): 0.011
Number of copies: 1

28S ribosomal protein S22, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S22, mitochondrial
Theoretical weight (MDa): 0.041
Number of copies: 1

28S ribosomal protein S23, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S23, mitochondrial
Theoretical weight (MDa): 0.022
Number of copies: 1

28S ribosomal protein S25, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S25, mitochondrial
Theoretical weight (MDa): 0.02
Number of copies: 1

28S ribosomal protein S26, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S26, mitochondrial
Theoretical weight (MDa): 0.024
Number of copies: 1

28S ribosomal protein S27, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S27, mitochondrial
Theoretical weight (MDa): 0.048
Number of copies: 1

28S ribosomal protein S28, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S28, mitochondrial
Theoretical weight (MDa): 0.021
Number of copies: 1

28S ribosomal protein S29, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S29, mitochondrial
Theoretical weight (MDa): 0.046
Number of copies: 1

28S ribosomal protein S31, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S31, mitochondrial
Theoretical weight (MDa): 0.045
Number of copies: 1

28S ribosomal protein S33, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S33, mitochondrial
Theoretical weight (MDa): 0.013
Number of copies: 1

28S ribosomal protein S34, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S34, mitochondrial
Theoretical weight (MDa): 0.026
Number of copies: 1

28S ribosomal protein S35, mitochondrial [Human]

Protein type
Name: 28S ribosomal protein S35, mitochondrial
Theoretical weight (MDa): 0.037
Number of copies: 1

Coiled-coil-helix-coiled-coil-helix domain-containing protein 1 [Human]

Protein type
Name: Coiled-coil-helix-coiled-coil-helix domain-containing protein 1
Theoretical weight (MDa): 0.013
Number of copies: 1

Aurora kinase A-interacting protein [Human]

Protein type
Name: Aurora kinase A-interacting protein
Theoretical weight (MDa): 0.022
Number of copies: 1

Pentatricopeptide repeat domain-containing protein 3, mitochondrial [Human]

Protein type
Name: Pentatricopeptide repeat domain-containing protein 3, mitochondrial
Theoretical weight (MDa): 0.079
Number of copies: 1

A-site tRNA [Human]

Nucleic-acid type
Name: A-site tRNA
Theoretical weight (MDa): 0.022
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: UGGUAUAUAGUUUAAACAAAACGAAUGAUUUCGACUCAUUAAAUUAUGAUAAUCAUAUUUACCAACCA

P-site tRNA [Human]

Nucleic-acid type
Name: P-site tRNA
Theoretical weight (MDa): 0.022
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: UAGGGAAUAGUUUAAAAAACAGCUGACUUUCAAUCAGCAGAUGGAGGUUCAAUUCCUCCUUCCCUAACCA

mRNA [Human]

Nucleic-acid type
Name: mRNA
Theoretical weight (MDa): 0.006
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: UUUAAGAACGUGUUUAUUU

MAGNESIUM ION

Ligand type
Name: MAGNESIUM ION
Theoretical weight (MDa): 0
Number of copies: 189

POTASSIUM ION

Ligand type
Name: POTASSIUM ION
Theoretical weight (MDa): 0
Number of copies: 44

ZINC ION

Ligand type
Name: ZINC ION
Theoretical weight (MDa): 0
Number of copies: 3

FE2/S2 (INORGANIC) CLUSTER

Ligand type
Name: FE2/S2 (INORGANIC) CLUSTER
Theoretical weight (MDa): 0
Number of copies: 3

ADENOSINE-5'-TRIPHOSPHATE

Ligand type
Name: ADENOSINE-5'-TRIPHOSPHATE
Theoretical weight (MDa): 0.001
Number of copies: 1

GUANOSINE-5'-TRIPHOSPHATE

Ligand type
Name: GUANOSINE-5'-TRIPHOSPHATE
Theoretical weight (MDa): 0.001
Number of copies: 1

water

Ligand type
Name: water
Theoretical weight (MDa): 0
Number of copies: 470