EMD-0704 Function and Biology

Structure of LbCas12a-crRNA complex bound to AcrVA4 (form A complex)

Single particle reconstruction
3.25Å resolution
Overview of EMD-0704
Sample name: LbCas12a-crRNA complex bound to AcrVA4 (form A complex)
Number of unique components: 6

LbCas12a-crRNA complex bound to AcrVA4 (form A complex) [Lachnospiraceae bacterium]

Protein type
Name: LbCas12a-crRNA complex bound to AcrVA4 (form A complex)
Experimental weight (MDa): 0.17
Expression system
Expression system: Escherichia coli
Strain: BL21

LbCas12a [Lachnospiraceae bacterium]

Protein type
Name: LbCas12a
Theoretical weight (MDa): 0.144
Number of copies: 1
Expression system
Expression system: Escherichia coli BL21

AcrVA4 [Moraxella bovoculi]

Protein type
Name: AcrVA4
Theoretical weight (MDa): 0.027
Number of copies: 2
Expression system
Expression system: Escherichia coli BL21

RNA (42-MER) [synthetic construct]

Nucleic-acid type
Name: RNA (42-MER)
Theoretical weight (MDa): 0.013
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: AAUUUCUACUAAGUGUAGAUCGGUCUCGCAAAGAAUGGAUAU

MAGNESIUM ION

Ligand type
Name: MAGNESIUM ION
Theoretical weight (MDa): 0
Number of copies: 2

water

Ligand type
Name: water
Theoretical weight (MDa): 0
Number of copies: 6